Rh5AG369300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000811
Physical Location & Seq
Reverse (-)
62476448 .. 62477390
943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG369300.1

Sequence Viewer

Length: 225 bp
ATGTTACTGGAACTCTTCTCGATGTACCGTGAGTGGCAGGAGGAGAATGTCAAAAAGCTGAGCCAAAAACAGGTAGAGATTGGGGAACTTAAAGGAAGGTTGACGGAGGTTATTAGCAACTGTGATGCAGTGTGCAAGAGAATATCCGCAGAAGGACCAGAGTCTCTTCGGTCATCTGTCAAGCCATTAGTTATCTGCACCGCACACCAAGAACACCAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.46

Weight (kDa)

6.09

Isoelectric Point (pI)

52.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 147, 201
AfaI GTAC 1 cut(s) 26
AfiI CCNNNNNNNGG 1 cut(s) 70
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
Alw26I GTCTC 1 cut(s) 168
AspS9I GGNCC 1 cut(s) 155
AvaII GGWCC 1 cut(s) 155
BcoDI GTCTC 1 cut(s) 168
BlpI GCTNAGC 1 cut(s) 59
Bme18I GGWCC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 155
BmsI GCATC 1 cut(s) 115
BoxI GACNNNNGTC 1 cut(s) 160
Bpu1102I GCTNAGC 1 cut(s) 59
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse1I ACTGG 1 cut(s) 12
BseLI CCNNNNNNNGG 1 cut(s) 70
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 56
BsgI GTGCAG 1 cut(s) 181
BslI CCNNNNNNNGG 1 cut(s) 70
BsmAI GTCTC 1 cut(s) 168
Bsp1720I GCTNAGC 1 cut(s) 59
BspACI CCGC 2 cut(s) 147, 201
BspCNI CTCAG 1 cut(s) 51
BsrI ACTGG 1 cut(s) 12
Bst4CI ACNGT 2 cut(s) 29, 122
Bst6I CTCTTC 2 cut(s) 20, 171
BstDEI CTNAG 1 cut(s) 59
BstMAI GTCTC 1 cut(s) 168
BstPAI GACNNNNGTC 1 cut(s) 160
BtsI GCAGTG 1 cut(s) 135
BtsIMutI CAGTG 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 155
Csp6I GTAC 1 cut(s) 25
CviJI RGCY 3 cut(s) 58, 63, 184
CviKI_1 RGCY 3 cut(s) 58, 63, 184
CviQI GTAC 1 cut(s) 25
DdeI CTNAG 1 cut(s) 59
Eam1104I CTCTTC 2 cut(s) 20, 171
EarI CTCTTC 2 cut(s) 20, 171
Eco47I GGWCC 1 cut(s) 155
HincII GTYRAC 1 cut(s) 102
HindII GTYRAC 1 cut(s) 102
HinfI GANTC 1 cut(s) 161
Hpy166II GTNNAC 1 cut(s) 102
Hpy188III TCNNGA 2 cut(s) 19, 222
Hpy8I GTNNAC 1 cut(s) 102
HpyAV CCTTC 2 cut(s) 90, 146
HpyCH4III ACNGT 2 cut(s) 29, 122
HpyCH4V TGCA 3 cut(s) 128, 135, 198
HpyF3I CTNAG 1 cut(s) 59
LpnPI CCDG 3 cut(s) 23, 56, 171
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 3
MboII GAAGA 2 cut(s) 7, 158
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 2 cut(s) 34, 100
MseI TTAA 1 cut(s) 90
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PshAI GACNNNNGTC 1 cut(s) 160
PspPI GGNCC 1 cut(s) 155
RsaI GTAC 1 cut(s) 26
RsaNI GTAC 1 cut(s) 25
SaqAI TTAA 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 155
SchI GAGTC 1 cut(s) 170
SetI ASST 4 cut(s) 60, 75, 101, 111
SfaNI GCATC 1 cut(s) 115
SgeI CNNG 9 cut(s) 20, 31, 41, 50, 83, 148, 170, 193, 221
SinI GGWCC 1 cut(s) 155
SsiI CCGC 2 cut(s) 147, 201
TaaI ACNGT 2 cut(s) 29, 122
TaqI TCGA 1 cut(s) 20
TaqII GACCGA 1 cut(s) 159
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TscAI CASTG 1 cut(s) 135
TspGWI ACGGA 1 cut(s) 119
TspRI CASTG 1 cut(s) 135
VpaK11BI GGWCC 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.