Rh6BG241100

poly ADP-ribose polymerase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
44879394 .. 44879786
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG241100.1

Sequence Viewer

Length: 393 bp
ATGCTAGAAGCTCTCCAGGACATTGAAATTGCTTCCAGATTAGTCGGTTTTGATGCTAATAGTGATGACTCTTTGGATGAGAAGTATAAGAAGCTTCGGTGTTGTATGAATCCACTTCTTCACGATAGTGAAGATTATCAGTTGATTGAAAAGTATCTTCTTACTACTCATGCCCCTACACATACGGTGGGTTTGCATTTTGATACTCTAGAGCATATTGTCCTGGTGAAAAATTTGAATATACTCAAAATTTTAATGTCAATTCATTTATTTATGCAAATCTTGTTTCTGGCATCTGATGAGATTATCAGGATTGGAGTCTTGAACTTGAAGAAGTTTTTTCACTTGAAAGGGAAGGGGAATTCAATAAATACGCTCCTTGTGATCATCTGA

Protein Analysis

130

Amino Acids

14.9

Weight (kDa)

6.13

Isoelectric Point (pI)

41.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 232, 249, 361
AgsI TTSAA 7 cut(s) 26, 149, 238, 325, 331, 349, 366
AjnI CCWGG 2 cut(s) 15, 222
AleI CACNNNNGTG 1 cut(s) 126
AluBI AGCT 2 cut(s) 11, 94
AluI AGCT 2 cut(s) 11, 94
ApoI RAATTY 3 cut(s) 232, 249, 361
AsuHPI GGTGA 1 cut(s) 238
BciT130I CCWGG 2 cut(s) 17, 224
BclI TGATCA 1 cut(s) 384
BfaI CTAG 2 cut(s) 5, 209
Bme1390I CCNGG 2 cut(s) 17, 224
BmrFI CCNGG 2 cut(s) 17, 224
BmsI GCATC 2 cut(s) 43, 302
BseBI CCWGG 2 cut(s) 17, 224
BseGI GGATG 1 cut(s) 82
Bsp143I GATC 1 cut(s) 384
BssMI GATC 1 cut(s) 384
Bst2UI CCWGG 2 cut(s) 17, 224
Bst4CI ACNGT 1 cut(s) 187
BstF5I GGATG 1 cut(s) 82
BstKTI GATC 1 cut(s) 387
BstMBI GATC 1 cut(s) 384
BstNI CCWGG 2 cut(s) 17, 224
BstSCI CCNGG 2 cut(s) 15, 222
BtsCI GGATG 1 cut(s) 82
CviAII CATG 1 cut(s) 170
CviJI RGCY 2 cut(s) 11, 94
CviKI_1 RGCY 2 cut(s) 11, 94
DpnI GATC 1 cut(s) 386
DpnII GATC 1 cut(s) 384
EcoRI GAATTC 1 cut(s) 361
EcoRII CCWGG 2 cut(s) 15, 222
FaeI CATG 1 cut(s) 173
FaiI YATR 7 cut(s) 87, 107, 171, 183, 216, 242, 275
FatI CATG 1 cut(s) 169
FbaI TGATCA 1 cut(s) 384
FokI GGATG 1 cut(s) 89
FspBI CTAG 2 cut(s) 5, 209
Hin1II CATG 1 cut(s) 173
HindIII AAGCTT 1 cut(s) 92
HinfI GANTC 3 cut(s) 68, 109, 318
HphI GGTGA 1 cut(s) 238
Hpy188I TCNGA 2 cut(s) 298, 392
Hpy188III TCNNGA 5 cut(s) 36, 122, 209, 310, 322
HpyAV CCTTC 1 cut(s) 349
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 2 cut(s) 196, 277
Hsp92II CATG 1 cut(s) 173
Ksp22I TGATCA 1 cut(s) 384
Kzo9I GATC 1 cut(s) 384
LmnI GCTCC 1 cut(s) 381
LpnPI CCDG 7 cut(s) 2, 29, 49, 209, 236, 275, 295
LweI GCATC 2 cut(s) 43, 302
MaeI CTAG 2 cut(s) 5, 209
MalI GATC 1 cut(s) 386
MboI GATC 1 cut(s) 384
MboII GAAGA 4 cut(s) 110, 143, 149, 343
MluCI AATT 5 cut(s) 27, 232, 249, 261, 361
MlyI GAGTC 2 cut(s) 62, 327
MseI TTAA 1 cut(s) 254
MslI CAYNNNNRTG 1 cut(s) 126
MspR9I CCNGG 2 cut(s) 17, 224
MvaI CCWGG 2 cut(s) 17, 224
NdeII GATC 1 cut(s) 384
NlaIII CATG 1 cut(s) 173
OliI CACNNNNGTG 1 cut(s) 126
PfeI GAWTC 1 cut(s) 109
PfoI TCCNGGA 1 cut(s) 15
PleI GAGTC 2 cut(s) 62, 326
PpsI GAGTC 2 cut(s) 62, 326
Psp6I CCWGG 2 cut(s) 15, 222
PspGI CCWGG 2 cut(s) 15, 222
RseI CAYNNNNRTG 1 cut(s) 126
SaqAI TTAA 1 cut(s) 254
Sau3AI GATC 1 cut(s) 384
SchI GAGTC 2 cut(s) 62, 327
ScrFI CCNGG 2 cut(s) 17, 224
SetI ASST 2 cut(s) 13, 96
SfaNI GCATC 2 cut(s) 43, 302
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 5 cut(s) 27, 232, 249, 261, 361
SspMI CTAG 2 cut(s) 5, 209
StyD4I CCNGG 2 cut(s) 15, 222
TaaI ACNGT 1 cut(s) 187
TasI AATT 5 cut(s) 27, 232, 249, 261, 361
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 1 cut(s) 254
Tru9I TTAA 1 cut(s) 254
TspDTI ATGAA 2 cut(s) 122, 254
XapI RAATTY 3 cut(s) 232, 249, 361
XbaI TCTAGA 1 cut(s) 208
XspI CTAG 2 cut(s) 5, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.