Rh6BG167600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0000811
Physical Location & Seq
Reverse (-)
27472772 .. 27479848
7077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG167600.1

Sequence Viewer

Length: 171 bp
ATGAAAAATGAGTCTATGGATTATATATGGTGGCAGGCAGTGAATCTGCGGAAACAAAGGAGCCTCGTCGCTTGGTCGACGCCATTACTGACTTCACCCCCAAGTGAGGGTAGCTTGACTGACATTTTAGTGAGGAAACCTTCGTCTTCTTCAGCTCCCAAATTTTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.34

Weight (kDa)

9.51

Isoelectric Point (pI)

66.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 77
AciI CCGC 1 cut(s) 49
AcsI RAATTY 1 cut(s) 161
AcuI CTGAAG 1 cut(s) 135
AcyI GRCGYC 1 cut(s) 80
AfiI CCNNNNNNNGG 2 cut(s) 106, 107
AluBI AGCT 2 cut(s) 114, 155
AluI AGCT 2 cut(s) 114, 155
ApoI RAATTY 1 cut(s) 161
AsuHPI GGTGA 1 cut(s) 87
BbsI GAAGAC 1 cut(s) 138
BmiI GGNNCC 1 cut(s) 62
BpiI GAAGAC 1 cut(s) 138
BsaHI GRCGYC 1 cut(s) 80
Bsc4I CCNNNNNNNGG 2 cut(s) 106, 107
BseLI CCNNNNNNNGG 2 cut(s) 106, 107
BslI CCNNNNNNNGG 2 cut(s) 106, 107
BspACI CCGC 1 cut(s) 49
BspLI GGNNCC 1 cut(s) 62
BssNI GRCGYC 1 cut(s) 80
BstACI GRCGYC 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 36
BstV2I GAAGAC 1 cut(s) 138
BtsI GCAGTG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 36
CseI GACGC 1 cut(s) 88
CviJI RGCY 3 cut(s) 63, 114, 155
CviKI_1 RGCY 3 cut(s) 63, 114, 155
Eco57I CTGAAG 1 cut(s) 135
FaiI YATR 4 cut(s) 17, 24, 26, 28
FblI GTMKAC 1 cut(s) 77
HgaI GACGC 1 cut(s) 88
Hin1I GRCGYC 1 cut(s) 80
HincII GTYRAC 1 cut(s) 78
HindII GTYRAC 1 cut(s) 78
HinfI GANTC 2 cut(s) 11, 43
HphI GGTGA 1 cut(s) 87
Hpy166II GTNNAC 1 cut(s) 78
Hpy8I GTNNAC 1 cut(s) 78
Hpy99I CGWCG 2 cut(s) 71, 82
HpyAV CCTTC 1 cut(s) 150
Hsp92I GRCGYC 1 cut(s) 80
LmnI GCTCC 2 cut(s) 60, 160
LpnPI CCDG 1 cut(s) 20
MboII GAAGA 2 cut(s) 138, 141
MluCI AATT 1 cut(s) 161
MlyI GAGTC 1 cut(s) 20
MnlI CCTC 3 cut(s) 74, 100, 126
MslI CAYNNNNRTG 1 cut(s) 128
NlaIV GGNNCC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 43
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
PspN4I GGNNCC 1 cut(s) 62
RseI CAYNNNNRTG 1 cut(s) 128
SalI GTCGAC 1 cut(s) 76
SchI GAGTC 1 cut(s) 20
SetI ASST 3 cut(s) 116, 142, 157
SgeI CNNG 5 cut(s) 47, 77, 84, 114, 127
SmiMI CAYNNNNRTG 1 cut(s) 128
Sse9I AATT 1 cut(s) 161
SsiI CCGC 1 cut(s) 49
TaqI TCGA 1 cut(s) 77
TasI AATT 1 cut(s) 161
TfiI GAWTC 1 cut(s) 43
TscAI CASTG 1 cut(s) 45
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 45
XapI RAATTY 1 cut(s) 161
XmiI GTMKAC 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.