Rroxscaffold_5G00382790

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000811
Physical Location & Seq
Forward (+)
62582491 .. 62583398
908 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00382790.1

Sequence Viewer

Length: 189 bp
ATGTTACTGGAACTCTTCTCGATGTACCGTGAGTGGCAGGAGGAGAATGTCAAAAAGCTGAGCCAAAAACAGGTAGAGATTGGGGAACTTAAAGGAAGGTTGACGGAGGTTATTAGCAACCGTGATGCGGTGTGCAAGAGAATATCCGCAGAAGGACCGAGTCTCTTCGGTCATCTGTCAAGCCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.15

Weight (kDa)

6.72

Isoelectric Point (pI)

34.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 128, 147
AfaI GTAC 1 cut(s) 26
AfiI CCNNNNNNNGG 2 cut(s) 70, 127
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
Alw26I GTCTC 1 cut(s) 167
AspS9I GGNCC 1 cut(s) 155
AvaII GGWCC 1 cut(s) 155
BcoDI GTCTC 1 cut(s) 167
BlpI GCTNAGC 1 cut(s) 59
Bme18I GGWCC 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 155
BmsI GCATC 1 cut(s) 115
Bpu1102I GCTNAGC 1 cut(s) 59
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 127
Bse1I ACTGG 1 cut(s) 12
BseLI CCNNNNNNNGG 2 cut(s) 70, 127
BseMII CTCAG 1 cut(s) 50
BseNI ACTGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 56
BslI CCNNNNNNNGG 2 cut(s) 70, 127
BsmAI GTCTC 1 cut(s) 167
Bsp1720I GCTNAGC 1 cut(s) 59
BspACI CCGC 2 cut(s) 128, 147
BspCNI CTCAG 1 cut(s) 51
BsrI ACTGG 1 cut(s) 12
Bst4CI ACNGT 2 cut(s) 29, 122
Bst6I CTCTTC 2 cut(s) 20, 170
BstDEI CTNAG 1 cut(s) 59
BstMAI GTCTC 1 cut(s) 167
Cfr13I GGNCC 1 cut(s) 155
Csp6I GTAC 1 cut(s) 25
CviJI RGCY 3 cut(s) 58, 63, 183
CviKI_1 RGCY 3 cut(s) 58, 63, 183
CviQI GTAC 1 cut(s) 25
DdeI CTNAG 1 cut(s) 59
Eam1104I CTCTTC 2 cut(s) 20, 170
EarI CTCTTC 2 cut(s) 20, 170
Eco47I GGWCC 1 cut(s) 155
HincII GTYRAC 1 cut(s) 102
HindII GTYRAC 1 cut(s) 102
HinfI GANTC 1 cut(s) 160
Hpy166II GTNNAC 1 cut(s) 102
Hpy188III TCNNGA 1 cut(s) 19
Hpy8I GTNNAC 1 cut(s) 102
HpyAV CCTTC 2 cut(s) 90, 146
HpyCH4III ACNGT 2 cut(s) 29, 122
HpyCH4V TGCA 1 cut(s) 135
HpyF3I CTNAG 1 cut(s) 59
LpnPI CCDG 2 cut(s) 23, 56
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 3
MboII GAAGA 2 cut(s) 7, 157
MlyI GAGTC 1 cut(s) 169
MnlI CCTC 2 cut(s) 34, 100
MseI TTAA 1 cut(s) 90
PflFI GACNNNGTC 1 cut(s) 159
PleI GAGTC 1 cut(s) 168
PpsI GAGTC 1 cut(s) 168
PspPI GGNCC 1 cut(s) 155
PsyI GACNNNGTC 1 cut(s) 159
RsaI GTAC 1 cut(s) 26
RsaNI GTAC 1 cut(s) 25
SaqAI TTAA 1 cut(s) 90
Sau96I GGNCC 1 cut(s) 155
SchI GAGTC 1 cut(s) 169
SetI ASST 4 cut(s) 60, 75, 101, 111
SfaNI GCATC 1 cut(s) 115
SgeI CNNG 8 cut(s) 20, 31, 41, 50, 83, 134, 148, 171
SinI GGWCC 1 cut(s) 155
SsiI CCGC 2 cut(s) 128, 147
TaaI ACNGT 2 cut(s) 29, 122
TaqI TCGA 1 cut(s) 20
TaqII GACCGA 2 cut(s) 158, 172
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
TspGWI ACGGA 1 cut(s) 119
Tth111I GACNNNGTC 1 cut(s) 159
VpaK11BI GGWCC 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.