Rh5AG496300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000811
Physical Location & Seq
Reverse (-)
84333260 .. 84333604
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG496300.1

Sequence Viewer

Length: 345 bp
ATGAACGTCAGTTTTCTAATGAATAAGCTTGTATTGAAGTATCTTAAGAAGATATTTGCAGATATCTGGTCGTGTAGAGAGGGAATGATCATTAAGATTATGGGTAAGTATTATGCTTTTGTAGCATTATTAGTCATGGGAACTTCTTTTATAGCATTATGGGTAAGTATTATGCTTTTGATCAAAATATTTTCTGCAGTCTTTATCCTCTGCTTCCCTCTTCCCTCTTCCCCTGAATTTTATAGTAGGAACTACGAAAATGAAAGCAGTTCTGTATTAAGCATATTAGTTCTCCTGCTAATATTTTTCACACTTCCTGCTGGTAATCATAAAGTACTTGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

114

Amino Acids

12.98

Weight (kDa)

9.39

Isoelectric Point (pI)

40.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 236
AfaI GTAC 1 cut(s) 336
AflII CTTAAG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
ApoI RAATTY 1 cut(s) 236
BclI TGATCA 2 cut(s) 87, 180
BfmI CTRYAG 1 cut(s) 195
BfrI CTTAAG 1 cut(s) 44
BmcAI AGTACT 1 cut(s) 336
Bsp143I GATC 2 cut(s) 87, 180
BspMAI CTGCAG 1 cut(s) 199
BspTI CTTAAG 1 cut(s) 44
BssMI GATC 2 cut(s) 87, 180
Bst6I CTCTTC 2 cut(s) 225, 232
BstAFI CTTAAG 1 cut(s) 44
BstKTI GATC 2 cut(s) 90, 183
BstMBI GATC 2 cut(s) 87, 180
BstMWI GCNNNNNNNGC 1 cut(s) 122
BstSFI CTRYAG 1 cut(s) 195
Csp6I GTAC 1 cut(s) 335
CviAII CATG 1 cut(s) 136
CviJI RGCY 2 cut(s) 28, 342
CviKI_1 RGCY 2 cut(s) 28, 342
CviQI GTAC 1 cut(s) 335
DpnI GATC 2 cut(s) 89, 182
DpnII GATC 2 cut(s) 87, 180
Eam1104I CTCTTC 2 cut(s) 225, 232
EarI CTCTTC 2 cut(s) 225, 232
Eco32I GATATC 1 cut(s) 64
EcoRV GATATC 1 cut(s) 64
FaeI CATG 1 cut(s) 139
FaiI YATR 9 cut(s) 101, 114, 137, 152, 160, 173, 243, 284, 330
FatI CATG 1 cut(s) 135
FbaI TGATCA 2 cut(s) 87, 180
Hin1II CATG 1 cut(s) 139
HindIII AAGCTT 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 2 cut(s) 59, 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 122
HpySE526I ACGT 1 cut(s) 6
Hsp92II CATG 1 cut(s) 139
Ksp22I TGATCA 2 cut(s) 87, 180
Kzo9I GATC 2 cut(s) 87, 180
LpnPI CCDG 5 cut(s) 52, 246, 306, 308, 330
MaeII ACGT 1 cut(s) 6
MalI GATC 2 cut(s) 89, 182
MboI GATC 2 cut(s) 87, 180
MboII GAAGA 3 cut(s) 61, 212, 219
MluCI AATT 1 cut(s) 236
MnlI CCTC 4 cut(s) 73, 218, 228, 235
MseI TTAA 3 cut(s) 45, 93, 278
MspCI CTTAAG 1 cut(s) 44
MwoI GCNNNNNNNGC 1 cut(s) 122
NdeII GATC 2 cut(s) 87, 180
NlaIII CATG 1 cut(s) 139
PstI CTGCAG 1 cut(s) 199
RsaI GTAC 1 cut(s) 336
RsaNI GTAC 1 cut(s) 335
SaqAI TTAA 3 cut(s) 45, 93, 278
Sau3AI GATC 2 cut(s) 87, 180
ScaI AGTACT 1 cut(s) 336
SetI ASST 2 cut(s) 9, 30
SfcI CTRYAG 1 cut(s) 195
SgeI CNNG 8 cut(s) 41, 79, 84, 148, 245, 307, 329, 333
SmlI CTYRAG 1 cut(s) 44
SmoI CTYRAG 1 cut(s) 44
Sse9I AATT 1 cut(s) 236
SspI AATATT 2 cut(s) 189, 303
TaiI ACGT 1 cut(s) 9
TasI AATT 1 cut(s) 236
TatI WGTACW 1 cut(s) 334
Tru1I TTAA 3 cut(s) 45, 93, 278
Tru9I TTAA 3 cut(s) 45, 93, 278
TspDTI ATGAA 3 cut(s) 17, 35, 276
Vha464I CTTAAG 1 cut(s) 44
XapI RAATTY 1 cut(s) 236
ZrmI AGTACT 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.