Rmu_sc0005178.1_g000001

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005178.1
Physical Location & Seq
Forward (+)
725 .. 2231
1507 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005178.1_g000001.1.cds

Sequence Viewer

Length: 759 bp
atggaagtagcagtggctagttgggtagcactgagccttgtttttgttagcatagtagtaagatgggcatggggtgtgctggattggttatggctgaagccgaagaagcttgaaagatatttgagggagcaaggccttaaaggcaattcctacaggctcttttatggagacatgaaggaaaactctgtcatgctcgcacaagcaaaatccaaacccatgaacctctcaagctcccatgacatagcatcacgattcatcccttttctcgatcaaaccgtgaaaacttacggtaaaaactcttttgtttggattggccccataccaagggtgaacattatggatcctgaagatgtgaaagatgtcttcacaaaactagatgatttccggaggccagcaacaaatccacttatcaagttgctaataacaggtattgcaagctatgaagatgagaaatgggctaaacatagaagaatcatcaacccaacgttccatgcagagaagctaaagcgtatgttaccggcatttcaccaaagttgtgatcagatgattaaggagtgggagagctgggtctcaaaacagggttcatcatgtgagttggatgtctggccttctcttcaaaatttaacggctgatgcgatttctcgaacagcgtttggaagtagctatgaagaaggtagaaaaatatttaaactcctaaaagagcaaacagcatacacaataaaaagcttgcaaagtgtttacattccaggatggaggtaa

Protein Analysis

252

Amino Acids

29.2

Weight (kDa)

9.44

Isoelectric Point (pI)

34.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000133)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G14610 AT3G14620 AT3G14630 AT3G14630 AT3G14640 AT3G14640 AT3G14650 AT3G14660 AT3G14660 AT3G14660 AT3G14680 AT3G14690 AT3G14690
fragaria_vesca FvH4_1g08410 FvH4_2g31040 FvH4_3g17200 FvH4_3g17200 FvH4_3g17220 FvH4_3g17220 FvH4_3g17240 FvH4_3g17240 FvH4_3g17240 FvH4_3g17240 FvH4_3g17240 FvH4_3g17240 FvH4_3g17240 FvH4_3g17260 FvH4_3g17260 FvH4_3g17263 FvH4_3g17264 FvH4_3g17265 FvH4_3g17266 FvH4_5g18530 FvH4_5g19690 FvH4_7g03990 FvH4_7g03990 FvH4_7g03990 FvH4_7g03990 FvH4_7g03990 FvH4_7g17900 FvH4_7g17900
malus_domestica MD02G1088200.v1.1 MD03G1224800.v1.1 MD03G1224900.v1.1 MD03G1225000.v1.1 MD11G1274100.v1.1 MD11G1274200.v1.1 MD11G1274300.v1.1 MD11G1274500.v1.1 MD11G1274600.v1.1 MD15G1050400.v1.1 MD15G1050500.v1.1 MD15G1050600.v1.1 MD15G1050700.v1.1
prunus_persica Prupe.1G404900_v2.0.a1 Prupe.1G404900_v2.0.a1 Prupe.4G152600_v2.0.a1 Prupe.4G152700_v2.0.a1 Prupe.4G152800_v2.0.a1 Prupe.4G152900_v2.0.a1 Prupe.4G153000_v2.0.a1 Prupe.7G201400_v2.0.a1 Prupe.7G201400_v2.0.a1
pyrus_communis pycom03g17310 pycom03g17330 pycom11g21520 pycom11g21600 pycom11g24180 pycom11g24190 pycom11g24200 pycom11g24210 pycom15g04890
rosa_chinensis RchiOBHm_Chr1g0327671 RchiOBHm_Chr1g0327711 RchiOBHm_Chr1g0327721 RchiOBHm_Chr2g0094501 RchiOBHm_Chr5g0028601 RchiOBHm_Chr5g0028611 RchiOBHm_Chr5g0028621 RchiOBHm_Chr5g0028661 RchiOBHm_Chr5g0028671 RchiOBHm_Chr5g0028701 RchiOBHm_Chr5g0028721 RchiOBHm_Chr5g0028741 RchiOBHm_Chr5g0028751 RchiOBHm_Chr5g0028771 RchiOBHm_Chr5g0028821 RchiOBHm_Chr6g0311761 RchiOBHm_Chr7g0204421
rosa_laevigata RLG00000003223 RLG00000003462 RLG00000010376 RLG00000012452 RLG00000016496 RLG00000018531 RLG00000018532 RLG00000018536 RLG00000029973 RLG00000029976 RLG00000033105 RLG00000033106 RLG00000033107 RLG00000033109 RLG00000033110 RLG00000033111 RLG00000033112 RLG00000033113 RLG00000033114 RLG00000033116 RLG00000033124
rosa_multiflora Rmu_co8029584.1_g000001 Rmu_co8159878.1_g000001 Rmu_co8310611.1_g000001 Rmu_sc0001000.1_g000004 Rmu_sc0001000.1_g000016 Rmu_sc0001575.1_g000020 Rmu_sc0001575.1_g000021 Rmu_sc0001575.1_g000022 Rmu_sc0001575.1_g000027 Rmu_sc0001575.1_g000035 Rmu_sc0001575.1_g000040 Rmu_sc0002888.1_g000039 Rmu_sc0003951.1_g000001 Rmu_sc0004359.1_g000045 Rmu_sc0005178.1_g000001 Rmu_sc0005178.1_g000002 Rmu_sc0005178.1_g000004 Rmu_sc0023855.1_g000001 Rmu_sc0024393.1_g000001 Rmu_sc0035326.1_g000001
rosa_roxburghii Rroxscaffold_1G00051080 Rroxscaffold_1G00051100 Rroxscaffold_1G00051110 Rroxscaffold_1G00051120 Rroxscaffold_1G00051150 Rroxscaffold_1G00051160 Rroxscaffold_1G00051170 Rroxscaffold_1G00051180 Rroxscaffold_2G00123610 Rroxscaffold_2G00147120 Rroxscaffold_3G00250540 Rroxscaffold_3G00253110 Rroxscaffold_3G00253120 Rroxscaffold_4G00322410 Rroxscaffold_4G00322440 Rroxscaffold_4G00322470 Rroxscaffold_7G00157330
rosa_rugosa Rorug01G0069500 Rorug01G0069600 Rorug01G0069700 Rorug02G0044200 Rorug02G0227700 Rorug05G0109800 Rorug05G0109900 Rorug05G0110000 Rorug05G0110100 Rorug05G0110300 Rorug05G0110400 Rorug05G0110500 Rorug07G0083800 Rorug07G0083900.1 Rorug07G0103700
rosa_samantha Rh1BG069000 Rh1BG069100 Rh1BG069200 Rh1CG084000 Rh1DG090700 Rh1DG090800 Rh1DG090900 Rh2AG092500 Rh2DG091600 Rh2DG309400 Rh5AG202100 Rh5AG202200 Rh5AG202500 Rh5AG202800 Rh5AG202900 Rh5CG220600 Rh5CG220700 Rh5CG220800 Rh5CG220900 Rh5CG221600 Rh5CG221900 Rh5CG222000 Rh5CG222100 Rh5DG203300 Rh5DG203400 Rh5DG203500 Rh5DG204100 Rh5DG204300 Rh5DG204400 Rh5DG204600 Rh6BG517600 Rh6CG523400 Rh6DG509100 Rh7AG213600 Rh7BG211400 Rh7DG220800
rosa_wichuraiana Rw0G010630 Rw1G006750 Rw1G006770 Rw5G018300 Rw5G018310 Rw5G018330 Rw6G044090 Rw7G018510 Rw7G020290

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 384
AclI AACGTT 1 cut(s) 485
AclWI GGATC 2 cut(s) 335, 348
AcsI RAATTY 1 cut(s) 619
AcuI CTGAAG 2 cut(s) 116, 366
AfiI CCNNNNNNNGG 1 cut(s) 324
AgsI TTSAA 2 cut(s) 113, 617
AjnI CCWGG 1 cut(s) 745
AluBI AGCT 7 cut(s) 109, 231, 438, 502, 564, 663, 726
AluI AGCT 7 cut(s) 109, 231, 438, 502, 564, 663, 726
Alw26I GTCTC 2 cut(s) 162, 574
AlwI GGATC 2 cut(s) 335, 348
Aor13HI TCCGGA 1 cut(s) 384
AoxI GGCC 4 cut(s) 133, 313, 389, 605
ApoI RAATTY 1 cut(s) 619
AspS9I GGNCC 1 cut(s) 314
AsuHPI GGTGA 2 cut(s) 340, 518
BamHI GGATCC 1 cut(s) 340
BbsI GAAGAC 1 cut(s) 355
BccI CCATC 2 cut(s) 57, 744
BceAI ACGGC 1 cut(s) 642
BciT130I CCWGG 1 cut(s) 747
BclI TGATCA 1 cut(s) 538
BcoDI GTCTC 2 cut(s) 162, 574
BfaI CTAG 2 cut(s) 18, 374
BfmI CTRYAG 1 cut(s) 151
BglI GCCNNNNNGGC 1 cut(s) 141
Bme1390I CCNGG 1 cut(s) 747
BmgT120I GGNCC 1 cut(s) 314
BmiI GGNNCC 2 cut(s) 316, 342
BmrFI CCNGG 1 cut(s) 747
BmsI GCATC 2 cut(s) 254, 622
BpiI GAAGAC 1 cut(s) 355
BpuEI CTTGAG 1 cut(s) 211
BsaI GGTCTC 1 cut(s) 574
BsaJI CCNNGG 1 cut(s) 323
BsaWI WCCGGW 1 cut(s) 384
Bsc4I CCNNNNNNNGG 1 cut(s) 324
Bse118I RCCGGY 1 cut(s) 517
BseAI TCCGGA 1 cut(s) 384
BseBI CCWGG 1 cut(s) 747
BseDI CCNNGG 1 cut(s) 323
BseGI GGATG 3 cut(s) 255, 604, 755
BseLI CCNNNNNNNGG 1 cut(s) 324
BseMII CTCAG 1 cut(s) 23
BseYI CCCAGC 1 cut(s) 564
BshFI GGCC 4 cut(s) 135, 315, 391, 607
BsiSI CCGG 2 cut(s) 385, 518
BslI CCNNNNNNNGG 1 cut(s) 324
BsmAI GTCTC 2 cut(s) 162, 574
BsnI GGCC 4 cut(s) 135, 315, 391, 607
Bso31I GGTCTC 1 cut(s) 574
Bsp13I TCCGGA 1 cut(s) 384
Bsp143I GATC 3 cut(s) 268, 340, 538
BspANI GGCC 4 cut(s) 135, 315, 391, 607
BspCNI CTCAG 1 cut(s) 24
BspEI TCCGGA 1 cut(s) 384
BspLI GGNNCC 2 cut(s) 316, 342
BspPI GGATC 2 cut(s) 335, 348
BspTNI GGTCTC 1 cut(s) 574
BsrFI RCCGGY 1 cut(s) 517
BssAI RCCGGY 1 cut(s) 517
BssECI CCNNGG 1 cut(s) 323
BssMI GATC 3 cut(s) 268, 340, 538
BssT1I CCWWGG 1 cut(s) 323
Bst2UI CCWGG 1 cut(s) 747
Bst4CI ACNGT 2 cut(s) 277, 290
Bst6I CTCTTC 1 cut(s) 618
BstC8I GCNNGC 4 cut(s) 195, 393, 436, 728
BstDEI CTNAG 1 cut(s) 32
BstF5I GGATG 3 cut(s) 255, 604, 755
BstKTI GATC 3 cut(s) 271, 343, 541
BstMAI GTCTC 2 cut(s) 162, 574
BstMBI GATC 3 cut(s) 268, 340, 538
BstMWI GCNNNNNNNGC 2 cut(s) 106, 141
BstNI CCWGG 1 cut(s) 747
BstSCI CCNGG 1 cut(s) 745
BstSFI CTRYAG 1 cut(s) 151
BstV2I GAAGAC 1 cut(s) 355
BstX2I RGATCY 1 cut(s) 340
BstYI RGATCY 1 cut(s) 340
BsuRI GGCC 4 cut(s) 135, 315, 391, 607
BtsCI GGATG 3 cut(s) 255, 604, 755
BtsI GCAGTG 1 cut(s) 18
BtsIMutI CAGTG 2 cut(s) 18, 29
Cac8I GCNNGC 4 cut(s) 195, 393, 436, 728
Cfr10I RCCGGY 1 cut(s) 517
Cfr13I GGNCC 1 cut(s) 314
CviAII CATG 7 cut(s) 69, 172, 190, 217, 236, 491, 588
DdeI CTNAG 1 cut(s) 32
DpnI GATC 3 cut(s) 270, 342, 540
DpnII GATC 3 cut(s) 268, 340, 538
DraI TTTAAA 1 cut(s) 688
Eam1104I CTCTTC 1 cut(s) 618
EarI CTCTTC 1 cut(s) 618
Eco130I CCWWGG 1 cut(s) 323
Eco147I AGGCCT 1 cut(s) 135
Eco31I GGTCTC 1 cut(s) 574
Eco57I CTGAAG 2 cut(s) 116, 366
EcoRII CCWGG 1 cut(s) 745
EcoT14I CCWWGG 1 cut(s) 323
ErhI CCWWGG 1 cut(s) 323
FaeI CATG 7 cut(s) 72, 175, 193, 220, 239, 494, 591
FatI CATG 7 cut(s) 68, 171, 189, 216, 235, 490, 587
FbaI TGATCA 1 cut(s) 538
FokI GGATG 2 cut(s) 242, 611
FspBI CTAG 2 cut(s) 18, 374
GsaI CCCAGC 1 cut(s) 568
HaeIII GGCC 4 cut(s) 135, 315, 391, 607
HapII CCGG 2 cut(s) 385, 518
Hin1II CATG 7 cut(s) 72, 175, 193, 220, 239, 494, 591
HindIII AAGCTT 2 cut(s) 107, 724
HinfI GANTC 2 cut(s) 252, 471
HpaII CCGG 2 cut(s) 385, 518
HphI GGTGA 2 cut(s) 340, 518
Hpy166II GTNNAC 2 cut(s) 331, 739
Hpy188I TCNGA 1 cut(s) 543
Hpy188III TCNNGA 5 cut(s) 249, 266, 344, 385, 642
Hpy8I GTNNAC 2 cut(s) 331, 739
HpyAV CCTTC 3 cut(s) 169, 618, 665
HpyCH4III ACNGT 2 cut(s) 277, 290
HpyCH4IV ACGT 1 cut(s) 485
HpyCH4V TGCA 3 cut(s) 434, 494, 730
HpyF10VI GCNNNNNNNGC 2 cut(s) 106, 141
HpyF3I CTNAG 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 485
Hsp92II CATG 7 cut(s) 72, 175, 193, 220, 239, 494, 591
Kpn2I TCCGGA 1 cut(s) 384
Ksp22I TGATCA 1 cut(s) 538
Kzo9I GATC 3 cut(s) 268, 340, 538
LmnI GCTCC 2 cut(s) 127, 236
LweI GCATC 2 cut(s) 254, 622
MaeI CTAG 2 cut(s) 18, 374
MaeII ACGT 1 cut(s) 485
MaeIII GTNAC 1 cut(s) 513
MalI GATC 3 cut(s) 270, 342, 540
MboI GATC 3 cut(s) 268, 340, 538
MboII GAAGA 7 cut(s) 115, 355, 359, 455, 480, 605, 680
MflI RGATCY 1 cut(s) 340
MluCI AATT 2 cut(s) 145, 619
MmeI TCCRAC 1 cut(s) 576
MnlI CCTC 4 cut(s) 117, 233, 381, 747
MroI TCCGGA 1 cut(s) 384
MseI TTAA 4 cut(s) 138, 549, 623, 687
MspI CCGG 2 cut(s) 385, 518
MspR9I CCNGG 1 cut(s) 747
MvaI CCWGG 1 cut(s) 747
MwoI GCNNNNNNNGC 2 cut(s) 106, 141
NdeII GATC 3 cut(s) 268, 340, 538
NlaIII CATG 7 cut(s) 72, 175, 193, 220, 239, 494, 591
NlaIV GGNNCC 2 cut(s) 316, 342
PceI AGGCCT 1 cut(s) 135
PcsI WCGNNNNNNNCGW 2 cut(s) 273, 632
PfeI GAWTC 2 cut(s) 252, 471
PfoI TCCNGGA 1 cut(s) 745
Psp1406I AACGTT 1 cut(s) 485
Psp6I CCWGG 1 cut(s) 745
PspFI CCCAGC 1 cut(s) 564
PspGI CCWGG 1 cut(s) 745
PspN4I GGNNCC 2 cut(s) 316, 342
PspPI GGNCC 1 cut(s) 314
PsuI RGATCY 1 cut(s) 340
SaqAI TTAA 4 cut(s) 138, 549, 623, 687
Sau3AI GATC 3 cut(s) 268, 340, 538
Sau96I GGNCC 1 cut(s) 314
ScrFI CCNGG 1 cut(s) 747
SfaNI GCATC 2 cut(s) 254, 622
SfcI CTRYAG 1 cut(s) 151
SmlI CTYRAG 1 cut(s) 226
SmoI CTYRAG 1 cut(s) 226
Sse9I AATT 2 cut(s) 145, 619
SseBI AGGCCT 1 cut(s) 135
SspI AATATT 1 cut(s) 684
SspMI CTAG 2 cut(s) 18, 374
StuI AGGCCT 1 cut(s) 135
StyD4I CCNGG 1 cut(s) 745
StyI CCWWGG 1 cut(s) 323
TaaI ACNGT 2 cut(s) 277, 290
TaiI ACGT 1 cut(s) 488
TaqI TCGA 2 cut(s) 267, 643
TasI AATT 2 cut(s) 145, 619
TfiI GAWTC 2 cut(s) 252, 471
Tru1I TTAA 4 cut(s) 138, 549, 623, 687
Tru9I TTAA 4 cut(s) 138, 549, 623, 687
TscAI CASTG 2 cut(s) 18, 36
TspDTI ATGAA 6 cut(s) 188, 233, 244, 456, 573, 681
TspRI CASTG 2 cut(s) 18, 36
XapI RAATTY 1 cut(s) 619
XspI CTAG 2 cut(s) 18, 374
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.