Rmu_sc0014274.1_g000001
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014274.1
Physical Location & Seq
Forward (+)
1 .. 992
992 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014274.1_g000001.1.cds

Sequence Viewer

Length: 596 bp
tgcaggtttcaggaagtgtgacttacaatggtcatggcatgcacgagtttgtgcctcagagaagtgctgcatatatcagtcaacatgatgttcatattggagaaatgacagttgcagaaaccttggctttttctgcaagatgccaaggggtcggacctcgttatgagatgctagcagagctaagtagaagagagaaagatgcaagtattaagccagatccagacttggatatctacatgaagggaatagcatcagaaagtaagagagcagcatttgtgacaaattatattctgaaggttttgggattggagggctgtgcaaataccttggtaggggatcaattgataaggggtatatctggaggacaaaagaagcgagtcacaactggtgagatgttagttggtcctgctaaggcactattcatggacgaaatatcgactggtttggatagttcaacaacttatcaaatagtgaattccatcaagcaatatgttcacattctccaagggactgcattcatctcactactgcagccagcacccgagacttatgatctatttgatgacattattgatagctatatttcacaagtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

197

Amino Acids

21.54

Weight (kDa)

5.33

Isoelectric Point (pI)

37.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 211, 344
AcsI RAATTY 1 cut(s) 474
AcuI CTGAAG 1 cut(s) 313
AfiI CCNNNNNNNGG 1 cut(s) 332
AgsI TTSAA 1 cut(s) 455
AluBI AGCT 2 cut(s) 180, 578
AluI AGCT 2 cut(s) 180, 578
Alw26I GTCTC 1 cut(s) 538
AlwI GGATC 2 cut(s) 211, 344
Ama87I CYCGRG 1 cut(s) 541
ApeKI GCWGC 3 cut(s) 67, 268, 531
ApoI RAATTY 1 cut(s) 474
AspS9I GGNCC 2 cut(s) 154, 403
AsuHPI GGTGA 1 cut(s) 400
AsuNHI GCTAGC 1 cut(s) 171
AvaI CYCGRG 1 cut(s) 541
AvaII GGWCC 2 cut(s) 154, 403
BauI CACGAG 1 cut(s) 43
BbvI GCAGC 3 cut(s) 54, 280, 543
BccI CCATC 1 cut(s) 487
BcoDI GTCTC 1 cut(s) 538
BfaI CTAG 1 cut(s) 172
BfmI CTRYAG 1 cut(s) 529
BisI GCNGC 3 cut(s) 68, 269, 532
BlsI GCNGC 3 cut(s) 69, 270, 533
Bme18I GGWCC 2 cut(s) 154, 403
BmeT110I CYCGRG 1 cut(s) 541
BmgT120I GGNCC 2 cut(s) 154, 403
BmsI GCATC 4 cut(s) 130, 158, 189, 259
BmtI GCTAGC 1 cut(s) 175
BpmI CTGGAG 1 cut(s) 380
Bpu10I CCTNAGC 1 cut(s) 410
BsaJI CCNNGG 4 cut(s) 122, 144, 326, 504
Bsc4I CCNNNNNNNGG 1 cut(s) 332
Bse1I ACTGG 2 cut(s) 390, 444
BseDI CCNNGG 4 cut(s) 122, 144, 326, 504
BseLI CCNNNNNNNGG 1 cut(s) 332
BseMII CTCAG 1 cut(s) 70
BseNI ACTGG 2 cut(s) 390, 444
BseXI GCAGC 3 cut(s) 54, 280, 543
BsiHKCI CYCGRG 1 cut(s) 541
BslFI GGGAC 1 cut(s) 522
BslI CCNNNNNNNGG 1 cut(s) 332
BsmAI GTCTC 1 cut(s) 538
BsmFI GGGAC 1 cut(s) 522
BsmI GAATGC 1 cut(s) 514
BsoBI CYCGRG 1 cut(s) 541
Bsp143I GATC 3 cut(s) 216, 336, 552
BspCNI CTCAG 1 cut(s) 69
BspMAI CTGCAG 1 cut(s) 533
BspOI GCTAGC 1 cut(s) 175
BspPI GGATC 2 cut(s) 211, 344
BsrI ACTGG 2 cut(s) 390, 444
BssECI CCNNGG 4 cut(s) 122, 144, 326, 504
BssMI GATC 3 cut(s) 216, 336, 552
BssSI CACGAG 1 cut(s) 43
BssT1I CCWWGG 4 cut(s) 122, 144, 326, 504
Bst2BI CACGAG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 111
Bst6I CTCTTC 1 cut(s) 183
BstC8I GCNNGC 3 cut(s) 40, 173, 536
BstDEI CTNAG 3 cut(s) 56, 181, 410
BstKTI GATC 3 cut(s) 219, 339, 555
BstMAI GTCTC 1 cut(s) 538
BstMBI GATC 3 cut(s) 216, 336, 552
BstMWI GCNNNNNNNGC 2 cut(s) 133, 177
BstNSI RCATGY 1 cut(s) 42
BstSFI CTRYAG 1 cut(s) 529
BstV1I GCAGC 3 cut(s) 54, 280, 543
BstX2I RGATCY 1 cut(s) 216
BstYI RGATCY 1 cut(s) 216
Cac8I GCNNGC 3 cut(s) 40, 173, 536
Cfr13I GGNCC 2 cut(s) 154, 403
CviAII CATG 5 cut(s) 34, 39, 85, 237, 423
CviJI RGCY 6 cut(s) 127, 180, 213, 314, 534, 578
CviKI_1 RGCY 6 cut(s) 127, 180, 213, 314, 534, 578
DdeI CTNAG 3 cut(s) 56, 181, 410
DpnI GATC 3 cut(s) 218, 338, 554
DpnII GATC 3 cut(s) 216, 336, 552
Eam1104I CTCTTC 1 cut(s) 183
EarI CTCTTC 1 cut(s) 183
Eco130I CCWWGG 4 cut(s) 122, 144, 326, 504
Eco32I GATATC 1 cut(s) 231
Eco47I GGWCC 2 cut(s) 154, 403
Eco57I CTGAAG 1 cut(s) 313
Eco88I CYCGRG 1 cut(s) 541
EcoRI GAATTC 1 cut(s) 474
EcoRV GATATC 1 cut(s) 231
EcoT14I CCWWGG 4 cut(s) 122, 144, 326, 504
ErhI CCWWGG 4 cut(s) 122, 144, 326, 504
FaeI CATG 5 cut(s) 37, 42, 88, 240, 426
FalI AAGNNNNNCTT 1 cut(s) 38
FaqI GGGAC 1 cut(s) 522
FatI CATG 5 cut(s) 33, 38, 84, 236, 422
Fnu4HI GCNGC 3 cut(s) 68, 269, 532
Fsp4HI GCNGC 3 cut(s) 68, 269, 532
FspBI CTAG 1 cut(s) 172
GluI GCNGC 3 cut(s) 68, 269, 532
GsuI CTGGAG 1 cut(s) 380
Hin1II CATG 5 cut(s) 37, 42, 88, 240, 426
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 1 cut(s) 377
HphI GGTGA 1 cut(s) 400
Hpy166II GTNNAC 2 cut(s) 82, 495
Hpy188I TCNGA 4 cut(s) 59, 154, 255, 293
Hpy188III TCNNGA 3 cut(s) 11, 220, 359
Hpy8I GTNNAC 2 cut(s) 82, 495
HpyAV CCTTC 2 cut(s) 234, 288
HpyCH4III ACNGT 1 cut(s) 111
HpyCH4V TGCA 9 cut(s) 3, 42, 70, 115, 136, 202, 319, 514, 531
HpyF10VI GCNNNNNNNGC 2 cut(s) 133, 177
HpyF3I CTNAG 3 cut(s) 56, 181, 410
Hsp92II CATG 5 cut(s) 37, 42, 88, 240, 426
Kzo9I GATC 3 cut(s) 216, 336, 552
LpnPI CCDG 7 cut(s) 227, 233, 344, 371, 419, 425, 548
Lsp1109I GCAGC 3 cut(s) 54, 280, 543
LweI GCATC 4 cut(s) 130, 158, 189, 259
MaeI CTAG 1 cut(s) 172
MaeIII GTNAC 3 cut(s) 18, 276, 378
MalI GATC 3 cut(s) 218, 338, 554
MboI GATC 3 cut(s) 216, 336, 552
MboII GAAGA 1 cut(s) 200
MfeI CAATTG 1 cut(s) 340
MflI RGATCY 1 cut(s) 216
MluCI AATT 3 cut(s) 282, 340, 474
MlyI GAGTC 1 cut(s) 386
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 4 cut(s) 65, 167, 303, 355
MseI TTAA 1 cut(s) 209
MunI CAATTG 1 cut(s) 340
Mva1269I GAATGC 1 cut(s) 514
MwoI GCNNNNNNNGC 2 cut(s) 133, 177
NdeII GATC 3 cut(s) 216, 336, 552
NheI GCTAGC 1 cut(s) 171
NlaIII CATG 5 cut(s) 37, 42, 88, 240, 426
NmuCI GTSAC 3 cut(s) 18, 276, 378
NspI RCATGY 1 cut(s) 42
PaeI GCATGC 1 cut(s) 42
PctI GAATGC 1 cut(s) 514
PkrI GCNGC 3 cut(s) 69, 270, 533
PleI GAGTC 1 cut(s) 385
PpsI GAGTC 1 cut(s) 385
PspPI GGNCC 2 cut(s) 154, 403
PstI CTGCAG 1 cut(s) 533
PsuI RGATCY 1 cut(s) 216
SaqAI TTAA 1 cut(s) 209
SatI GCNGC 3 cut(s) 68, 269, 532
Sau3AI GATC 3 cut(s) 216, 336, 552
Sau96I GGNCC 2 cut(s) 154, 403
SchI GAGTC 1 cut(s) 386
SetI ASST 7 cut(s) 8, 124, 159, 182, 299, 328, 580
SfaNI GCATC 4 cut(s) 130, 158, 189, 259
SfcI CTRYAG 1 cut(s) 529
SinI GGWCC 2 cut(s) 154, 403
SphI GCATGC 1 cut(s) 42
Sse9I AATT 3 cut(s) 282, 340, 474
SspMI CTAG 1 cut(s) 172
StyI CCWWGG 4 cut(s) 122, 144, 326, 504
TaaI ACNGT 1 cut(s) 111
TaqI TCGA 1 cut(s) 436
TasI AATT 3 cut(s) 282, 340, 474
Tru1I TTAA 1 cut(s) 209
Tru9I TTAA 1 cut(s) 209
TseFI GTSAC 3 cut(s) 18, 276, 378
TseI GCWGC 3 cut(s) 67, 268, 531
Tsp45I GTSAC 3 cut(s) 18, 276, 378
TspDTI ATGAA 4 cut(s) 82, 253, 411, 507
VpaK11BI GGWCC 2 cut(s) 154, 403
XapI RAATTY 1 cut(s) 474
XceI RCATGY 1 cut(s) 42
XspI CTAG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.