Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0001009

Physical Location & Seq

Genomic Coordinates Reverse (-)

31787376 .. 31787857

Gene Structure 482 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00025310.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 393 bp

ATGGGAAATGGGAAAGTGACTTACTGTGGCCATGAATTTAATGAATTTGTACCTCAGAGAACCTCTGCTTATATTTGCCAGCAAGATCTTCATTATGGTGAGATGACAGTTCGTGAAACATTTGATTTCTCTGGACGTTGCCTAGGAGTTGGAACAAGGTATGATATACTTGTAGAGTTGTCTAGACGGGAGAAAGATGGAGGTATCAAACCAGATCCTGGGATTGATGCATACATGAAAGCCACATCAGTGGCAGGACAGGAAACAAGTTTGATCACAGATTATGTTCTCAAGATACTTGGATTAGATATCTGTGCTGATATTATGGTGGGTCATGACATGAGAAGGGGAATATCTGGTGGACAAAAGAAGCGTGTCACGACTGGCATGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0008150 GO:0015399 GO:0015405 GO:0016020 GO:0016021 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0031224 GO:0042623 GO:0042626 GO:0043492 GO:0044425 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

130

Amino Acids

14.39

Weight (kDa)

6.28

Isoelectric Point (pI)

29.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001009)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g21872
rosa_chinensis	RchiOBHm_Chr2g0123681 RchiOBHm_Chr3g0479491 RchiOBHm_Chr3g0495041 RchiOBHm_Chr4g0441021 RchiOBHm_Chr5g0077811
rosa_laevigata	RLG00000002955 RLG00000006128 RLG00000014337 RLG00000017254 RLG00000017794 RLG00000018824 RLG00000020500 RLG00000021064 RLG00000022633 RLG00000023474 RLG00000034052 RLG00000034977 RLG00000035113
rosa_multiflora	Rmu_co7982184.1_g000001 Rmu_sc0001018.1_g000026 Rmu_sc0002302.1_g000019 Rmu_sc0004092.1_g000029 Rmu_sc0006432.1_g000003 Rmu_sc0014274.1_g000001 Rmu_sc0018911.1_g000009 Rmu_sc0028049.1_g000001
rosa_roxburghii	Rroxscaffold_1G00025310 Rroxscaffold_1G00070230 Rroxscaffold_2G00096810 Rroxscaffold_2G00096990 Rroxscaffold_3G00225320 Rroxscaffold_3G00247800 Rroxscaffold_3G00274690 Rroxscaffold_4G00297310 Rroxscaffold_4G00307210 Rroxscaffold_5G00336010 Rroxscaffold_5G00381920 Rroxscaffold_6G00398320
rosa_rugosa	Rorug02G0632200 Rorug07G0125300
rosa_samantha	Rh1AG414900 Rh1BG210400 Rh1CG235800 Rh2AG532500 Rh2BG232700 Rh2BG314600 Rh3AG318500 Rh3DG143100 Rh3DG252200 Rh4DG388600 Rh5AG088200 Rh5CG447300 Rh5DG116100 Rh6AG138700 Rh6BG076200 Rh6CG272500 Rh7AG212400 Rh7BG356600 Rh7BG449300 Rh7DG357700
rosa_wichuraiana	Rw6G042780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	218
AclWI	GGATC	1 cut(s)	209
AcoI	YGGCCR	1 cut(s)	28
AcsI	RAATTY	2 cut(s)	35, 44
AfaI	GTAC	1 cut(s)	51
AfiI	CCNNNNNNNGG	1 cut(s)	218
AjnI	CCWGG	1 cut(s)	217
AleI	CACNNNNGTG	1 cut(s)	248
AlwI	GGATC	1 cut(s)	209
AlwNI	CAGNNNCTG	1 cut(s)	218
AoxI	GGCC	1 cut(s)	28
ApoI	RAATTY	2 cut(s)	35, 44
AspA2I	CCTAGG	1 cut(s)	142
AsuHPI	GGTGA	1 cut(s)	110
AvrII	CCTAGG	1 cut(s)	142
BalI	TGGCCA	1 cut(s)	30
BccI	CCATC	1 cut(s)	191
BciT130I	CCWGG	1 cut(s)	219
BclI	TGATCA	1 cut(s)	273
BfaI	CTAG	2 cut(s)	143, 183
BglII	AGATCT	1 cut(s)	85
BlnI	CCTAGG	1 cut(s)	142
Bme1390I	CCNGG	1 cut(s)	219
BmrFI	CCNGG	1 cut(s)	219
BmsI	GCATC	1 cut(s)	217
BpuEI	CTTGAG	1 cut(s)	275
BsaJI	CCNNGG	2 cut(s)	142, 218
Bsc4I	CCNNNNNNNGG	1 cut(s)	218
Bse1I	ACTGG	1 cut(s)	388
BseBI	CCWGG	1 cut(s)	219
BseDI	CCNNGG	2 cut(s)	142, 218
BseLI	CCNNNNNNNGG	1 cut(s)	218
BseMII	CTCAG	1 cut(s)	68
BseNI	ACTGG	1 cut(s)	388
BshFI	GGCC	1 cut(s)	30
BslI	CCNNNNNNNGG	1 cut(s)	218
BsnI	GGCC	1 cut(s)	30
Bsp143I	GATC	3 cut(s)	85, 214, 273
BspANI	GGCC	1 cut(s)	30
BspCNI	CTCAG	1 cut(s)	67
BspHI	TCATGA	1 cut(s)	334
BspPI	GGATC	1 cut(s)	209
BsrI	ACTGG	1 cut(s)	388
BssECI	CCNNGG	2 cut(s)	142, 218
BssMI	GATC	3 cut(s)	85, 214, 273
BssT1I	CCWWGG	1 cut(s)	142
Bst2UI	CCWGG	1 cut(s)	219
Bst4CI	ACNGT	2 cut(s)	26, 109
BstC8I	GCNNGC	1 cut(s)	80
BstDEI	CTNAG	1 cut(s)	54
BstKTI	GATC	3 cut(s)	88, 217, 276
BstMBI	GATC	3 cut(s)	85, 214, 273
BstNI	CCWGG	1 cut(s)	219
BstNSI	RCATGY	1 cut(s)	391
BstSCI	CCNGG	1 cut(s)	217
BstX2I	RGATCY	2 cut(s)	85, 214
BstXI	CCANNNNNNTGG	1 cut(s)	250
BstYI	RGATCY	2 cut(s)	85, 214
BsuRI	GGCC	1 cut(s)	30
BtsIMutI	CAGTG	1 cut(s)	255
Cac8I	GCNNGC	1 cut(s)	80
CaiI	CAGNNNCTG	1 cut(s)	218
CciI	TCATGA	1 cut(s)	334
Csp6I	GTAC	1 cut(s)	50
CviAII	CATG	5 cut(s)	32, 235, 335, 340, 388
CviJI	RGCY	2 cut(s)	30, 242
CviKI_1	RGCY	2 cut(s)	30, 242
CviQI	GTAC	1 cut(s)	50
DdeI	CTNAG	1 cut(s)	54
DpnI	GATC	3 cut(s)	87, 216, 275
DpnII	GATC	3 cut(s)	85, 214, 273
EaeI	YGGCCR	1 cut(s)	28
Eco130I	CCWWGG	1 cut(s)	142
Eco32I	GATATC	1 cut(s)	310
EcoRII	CCWGG	1 cut(s)	217
EcoRV	GATATC	1 cut(s)	310
EcoT14I	CCWWGG	1 cut(s)	142
EcoT22I	ATGCAT	1 cut(s)	232
ErhI	CCWWGG	1 cut(s)	142
FaeI	CATG	5 cut(s)	35, 238, 338, 343, 391
FatI	CATG	5 cut(s)	31, 234, 334, 339, 387
FbaI	TGATCA	1 cut(s)	273
FspBI	CTAG	2 cut(s)	143, 183
HaeIII	GGCC	1 cut(s)	30
Hin1II	CATG	5 cut(s)	35, 238, 338, 343, 391
HphI	GGTGA	1 cut(s)	110
Hpy166II	GTNNAC	1 cut(s)	362
Hpy188I	TCNGA	1 cut(s)	57
Hpy188III	TCNNGA	6 cut(s)	113, 132, 183, 292, 335, 379
Hpy8I	GTNNAC	1 cut(s)	362
HpyAV	CCTTC	1 cut(s)	339
HpyCH4III	ACNGT	2 cut(s)	26, 109
HpyCH4IV	ACGT	1 cut(s)	136
HpyCH4V	TGCA	1 cut(s)	230
HpyF3I	CTNAG	1 cut(s)	54
HpySE526I	ACGT	1 cut(s)	136
Hsp92II	CATG	5 cut(s)	35, 238, 338, 343, 391
Ksp22I	TGATCA	1 cut(s)	273
Kzo9I	GATC	3 cut(s)	85, 214, 273
LpnPI	CCDG	9 cut(s)	92, 117, 204, 225, 231, 240, 245, 342, 369
LweI	GCATC	1 cut(s)	217
MaeI	CTAG	2 cut(s)	143, 183
MaeII	ACGT	1 cut(s)	136
MaeIII	GTNAC	2 cut(s)	16, 376
MalI	GATC	3 cut(s)	87, 216, 275
MboI	GATC	3 cut(s)	85, 214, 273
MboII	GAAGA	1 cut(s)	80
MflI	RGATCY	2 cut(s)	85, 214
MlsI	TGGCCA	1 cut(s)	30
MluCI	AATT	2 cut(s)	35, 44
MluNI	TGGCCA	1 cut(s)	30
MmeI	TCCRAC	1 cut(s)	130
MnlI	CCTC	3 cut(s)	63, 73, 194
Mox20I	TGGCCA	1 cut(s)	30
Mph1103I	ATGCAT	1 cut(s)	232
MscI	TGGCCA	1 cut(s)	30
MseI	TTAA	1 cut(s)	39
MslI	CAYNNNNRTG	2 cut(s)	96, 248
Msp20I	TGGCCA	1 cut(s)	30
MspR9I	CCNGG	1 cut(s)	219
MvaI	CCWGG	1 cut(s)	219
NdeII	GATC	3 cut(s)	85, 214, 273
NlaIII	CATG	5 cut(s)	35, 238, 338, 343, 391
NmuCI	GTSAC	2 cut(s)	16, 376
NsiI	ATGCAT	1 cut(s)	232
NspI	RCATGY	1 cut(s)	391
OliI	CACNNNNGTG	1 cut(s)	248
PagI	TCATGA	1 cut(s)	334
PflMI	CCANNNNNTGG	1 cut(s)	218
Psp6I	CCWGG	1 cut(s)	217
PspGI	CCWGG	1 cut(s)	217
PstNI	CAGNNNCTG	1 cut(s)	218
PsuI	RGATCY	2 cut(s)	85, 214
RsaI	GTAC	1 cut(s)	51
RsaNI	GTAC	1 cut(s)	50
RseI	CAYNNNNRTG	2 cut(s)	96, 248
SaqAI	TTAA	1 cut(s)	39
Sau3AI	GATC	3 cut(s)	85, 214, 273
ScrFI	CCNGG	1 cut(s)	219
SetI	ASST	5 cut(s)	55, 65, 139, 161, 205
SfaNI	GCATC	1 cut(s)	217
SmiMI	CAYNNNNRTG	2 cut(s)	96, 248
SmlI	CTYRAG	1 cut(s)	290
SmoI	CTYRAG	1 cut(s)	290
Sse9I	AATT	2 cut(s)	35, 44
SspMI	CTAG	2 cut(s)	143, 183
StyD4I	CCNGG	1 cut(s)	217
StyI	CCWWGG	1 cut(s)	142
TaaI	ACNGT	2 cut(s)	26, 109
TaiI	ACGT	1 cut(s)	139
TasI	AATT	2 cut(s)	35, 44
Tru1I	TTAA	1 cut(s)	39
Tru9I	TTAA	1 cut(s)	39
TscAI	CASTG	1 cut(s)	255
TseFI	GTSAC	2 cut(s)	16, 376
Tsp45I	GTSAC	2 cut(s)	16, 376
TspDTI	ATGAA	4 cut(s)	48, 57, 80, 251
TspRI	CASTG	1 cut(s)	255
Van91I	CCANNNNNTGG	1 cut(s)	218
XapI	RAATTY	2 cut(s)	35, 44
XbaI	TCTAGA	1 cut(s)	182
XceI	RCATGY	1 cut(s)	391
XmaJI	CCTAGG	1 cut(s)	142
XspI	CTAG	2 cut(s)	143, 183
Zsp2I	ATGCAT	1 cut(s)	232

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.