Rh2BG232700
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
23054390 .. 23066208
11819 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG232700.1

Sequence Viewer

Length: 186 bp
ATGCTTGCACTTCTGAGGCAATTACGGCTATTAAGGAGCAAGAGAAGCAAATTAACGATTTTAGACAACATTAGTGGGATTATAAGACCTTCAAGATTGACGTTGTTATTGGGTCCACCGAGCTCCGGCAAGACGACGCTACTATTGGCTCTCGCCGGACGCCTTGGAACTGGTCTTCAGACCTAA

Protein Analysis

61

Amino Acids

6.58

Weight (kDa)

12.0

Isoelectric Point (pI)

69.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 83
AcuI CTGAAG 1 cut(s) 161
AcyI GRCGYC 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 125
AgsI TTSAA 1 cut(s) 93
AluBI AGCT 1 cut(s) 123
AluI AGCT 1 cut(s) 123
Alw21I GWGCWC 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 113
AvaII GGWCC 1 cut(s) 113
BanII GRGCYC 1 cut(s) 125
BbsI GAAGAC 1 cut(s) 167
Bbv12I GWGCWC 1 cut(s) 125
BceAI ACGGC 1 cut(s) 41
Bme18I GGWCC 1 cut(s) 113
BmgT120I GGNCC 1 cut(s) 113
BmiI GGNNCC 1 cut(s) 114
BpiI GAAGAC 1 cut(s) 167
BsaHI GRCGYC 1 cut(s) 160
BsaJI CCNNGG 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 125
Bse1I ACTGG 1 cut(s) 175
BseDI CCNNGG 1 cut(s) 163
BseLI CCNNNNNNNGG 1 cut(s) 125
BseMII CTCAG 1 cut(s) 5
BseNI ACTGG 1 cut(s) 175
BsiHKAI GWGCWC 1 cut(s) 125
BsiSI CCGG 2 cut(s) 126, 156
BslI CCNNNNNNNGG 1 cut(s) 125
Bsp1286I GDGCHC 1 cut(s) 125
BspCNI CTCAG 1 cut(s) 6
BspLI GGNNCC 1 cut(s) 114
BsrI ACTGG 1 cut(s) 175
BssECI CCNNGG 1 cut(s) 163
BssNI GRCGYC 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 163
BstACI GRCGYC 1 cut(s) 160
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 14
BstMWI GCNNNNNNNGC 2 cut(s) 25, 45
BstV2I GAAGAC 1 cut(s) 167
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 113
CseI GACGC 2 cut(s) 145, 168
CspCI CAANNNNNGTGG 2 cut(s) 55, 90
CviJI RGCY 3 cut(s) 28, 123, 149
CviKI_1 RGCY 3 cut(s) 28, 123, 149
DdeI CTNAG 1 cut(s) 14
Ecl136II GAGCTC 1 cut(s) 123
Eco130I CCWWGG 1 cut(s) 163
Eco24I GRGCYC 1 cut(s) 125
Eco47I GGWCC 1 cut(s) 113
Eco53kI GAGCTC 1 cut(s) 123
Eco57I CTGAAG 1 cut(s) 161
EcoICRI GAGCTC 1 cut(s) 123
EcoT14I CCWWGG 1 cut(s) 163
EcoT38I GRGCYC 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 163
FaiI YATR 1 cut(s) 83
FriOI GRGCYC 1 cut(s) 125
HapII CCGG 2 cut(s) 126, 156
HgaI GACGC 2 cut(s) 145, 168
Hin1I GRCGYC 1 cut(s) 160
HpaII CCGG 2 cut(s) 126, 156
Hpy166II GTNNAC 1 cut(s) 116
Hpy188I TCNGA 2 cut(s) 15, 180
Hpy188III TCNNGA 1 cut(s) 93
Hpy8I GTNNAC 1 cut(s) 116
Hpy99I CGWCG 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 99
HpyCH4IV ACGT 1 cut(s) 101
HpyCH4V TGCA 1 cut(s) 8
HpyF10VI GCNNNNNNNGC 2 cut(s) 25, 45
HpyF3I CTNAG 1 cut(s) 14
HpySE526I ACGT 1 cut(s) 101
Hsp92I GRCGYC 1 cut(s) 160
LmnI GCTCC 2 cut(s) 36, 128
LpnPI CCDG 3 cut(s) 139, 156, 169
MaeII ACGT 1 cut(s) 101
MboII GAAGA 1 cut(s) 167
MhlI GDGCHC 1 cut(s) 125
MluCI AATT 2 cut(s) 20, 50
MnlI CCTC 1 cut(s) 9
MseI TTAA 2 cut(s) 32, 53
MspI CCGG 2 cut(s) 126, 156
MwoI GCNNNNNNNGC 2 cut(s) 25, 45
NlaIV GGNNCC 1 cut(s) 114
PsiI TTATAA 1 cut(s) 83
Psp124BI GAGCTC 1 cut(s) 125
PspN4I GGNNCC 1 cut(s) 114
PspPI GGNCC 1 cut(s) 113
SacI GAGCTC 1 cut(s) 125
SaqAI TTAA 2 cut(s) 32, 53
Sau96I GGNCC 1 cut(s) 113
SduI GDGCHC 1 cut(s) 125
SetI ASST 4 cut(s) 91, 104, 125, 185
SgeI CNNG 9 cut(s) 17, 52, 105, 132, 138, 142, 164, 168, 176
SinI GGWCC 1 cut(s) 113
Sse9I AATT 2 cut(s) 20, 50
SstI GAGCTC 1 cut(s) 125
StyI CCWWGG 1 cut(s) 163
TaiI ACGT 1 cut(s) 104
TasI AATT 2 cut(s) 20, 50
Tru1I TTAA 2 cut(s) 32, 53
Tru9I TTAA 2 cut(s) 32, 53
VpaK11BI GGWCC 1 cut(s) 113
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.