Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0028049.1

Orthogroup ID

OG0001009

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 801

Gene Structure 801 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0028049.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 267 bp

atgcaactgactaagaagaaaatggtattggaacatttagttgttggaaggttaaaggctcgaaacatcaaccaggaagagctagatgatatcattcgatacggatcaaaggagttatttgctgatgaaaatgatgaagcgggaaaatcccgtcaaattcattatgatgatgctgcgatagagagattacttgatcgtgaacaagctggggatgatgacactccgttggaggaaggagatgaagatggatttttaaaggcctttaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003676 GO:0003677 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006325 GO:0006338 GO:0006355 GO:0006996 GO:0007154 GO:0007165 GO:0007275 GO:0008150 GO:0008283 GO:0009719 GO:0009725 GO:0009733 GO:0009735 GO:0009736 GO:0009739 GO:0009755 GO:0009787 GO:0009788 GO:0009889 GO:0009890 GO:0009892 GO:0009966 GO:0009968 GO:0009987 GO:0010033 GO:0010468 GO:0010556 GO:0010558 GO:0010605 GO:0010629 GO:0010646 GO:0010648 GO:0016043 GO:0019219 GO:0019222 GO:0022622 GO:0023051 GO:0023052 GO:0023057 GO:0031323 GO:0031324 GO:0031326 GO:0031327 GO:0032501 GO:0032502 GO:0032870 GO:0033993 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0045892 GO:0045934 GO:0048364 GO:0048519 GO:0048523 GO:0048580 GO:0048583 GO:0048585 GO:0048731 GO:0048856 GO:0050789 GO:0050793 GO:0050794 GO:0050896 GO:0051171 GO:0051172 GO:0051239 GO:0051252 GO:0051253 GO:0051276 GO:0051716 GO:0060255 GO:0065007 GO:0070887 GO:0071310 GO:0071368 GO:0071495 GO:0071840 GO:0080090 GO:0097159 GO:0099402 GO:1901363 GO:1901419 GO:1901420 GO:1901700 GO:1902679 GO:1903506 GO:1903507 GO:1905957 GO:1905958 GO:2000023 GO:2000026 GO:2000069 GO:2000112 GO:2000113 GO:2000280 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko05165 ko05203 map05165 map05203

Pfam Domains

Protein Families

CHDCT2 Chromo DUF1086 DUF1087 Helicase_C PHD SNF2_N

Protein Analysis

89

Amino Acids

10.25

Weight (kDa)

4.62

Isoelectric Point (pI)

38.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001009)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g21872
rosa_chinensis	RchiOBHm_Chr2g0123681 RchiOBHm_Chr3g0479491 RchiOBHm_Chr3g0495041 RchiOBHm_Chr4g0441021 RchiOBHm_Chr5g0077811
rosa_laevigata	RLG00000002955 RLG00000006128 RLG00000014337 RLG00000017254 RLG00000017794 RLG00000018824 RLG00000020500 RLG00000021064 RLG00000022633 RLG00000023474 RLG00000034052 RLG00000034977 RLG00000035113
rosa_multiflora	Rmu_co7982184.1_g000001 Rmu_sc0001018.1_g000026 Rmu_sc0002302.1_g000019 Rmu_sc0004092.1_g000029 Rmu_sc0006432.1_g000003 Rmu_sc0014274.1_g000001 Rmu_sc0018911.1_g000009 Rmu_sc0028049.1_g000001
rosa_roxburghii	Rroxscaffold_1G00025310 Rroxscaffold_1G00070230 Rroxscaffold_2G00096810 Rroxscaffold_2G00096990 Rroxscaffold_3G00225320 Rroxscaffold_3G00247800 Rroxscaffold_3G00274690 Rroxscaffold_4G00297310 Rroxscaffold_4G00307210 Rroxscaffold_5G00336010 Rroxscaffold_5G00381920 Rroxscaffold_6G00398320
rosa_rugosa	Rorug02G0632200 Rorug07G0125300
rosa_samantha	Rh1AG414900 Rh1BG210400 Rh1CG235800 Rh2AG532500 Rh2BG232700 Rh2BG314600 Rh3AG318500 Rh3DG143100 Rh3DG252200 Rh4DG388600 Rh5AG088200 Rh5CG447300 Rh5DG116100 Rh6AG138700 Rh6BG076200 Rh6CG272500 Rh7AG212400 Rh7BG356600 Rh7BG449300 Rh7DG357700
rosa_wichuraiana	Rw6G042780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	140
AclWI	GGATC	1 cut(s)	112
AcsI	RAATTY	1 cut(s)	156
AjnI	CCWGG	1 cut(s)	72
AjuI	GAANNNNNNNTTGG	2 cut(s)	11, 43
AluBI	AGCT	2 cut(s)	82, 206
AluI	AGCT	2 cut(s)	82, 206
AlwI	GGATC	1 cut(s)	112
AoxI	GGCC	1 cut(s)	258
ApeKI	GCWGC	1 cut(s)	173
ApoI	RAATTY	1 cut(s)	156
BbvI	GCAGC	1 cut(s)	160
BccI	CCATC	1 cut(s)	239
BciT130I	CCWGG	1 cut(s)	74
BfaI	CTAG	1 cut(s)	83
BisI	GCNGC	1 cut(s)	174
BlsI	GCNGC	1 cut(s)	175
Bme1390I	CCNGG	1 cut(s)	74
BmrFI	CCNGG	1 cut(s)	74
BmsI	GCATC	1 cut(s)	160
BsaBI	GATNNNNATC	1 cut(s)	103
Bse8I	GATNNNNATC	1 cut(s)	103
BseBI	CCWGG	1 cut(s)	74
BseGI	GGATG	1 cut(s)	217
BseJI	GATNNNNATC	1 cut(s)	103
BseXI	GCAGC	1 cut(s)	160
BseYI	CCCAGC	1 cut(s)	206
BshFI	GGCC	1 cut(s)	260
BsnI	GGCC	1 cut(s)	260
Bsp143I	GATC	2 cut(s)	104, 193
BspACI	CCGC	1 cut(s)	140
BspANI	GGCC	1 cut(s)	260
BspPI	GGATC	1 cut(s)	112
BspQI	GCTCTTC	1 cut(s)	72
BssMI	GATC	2 cut(s)	104, 193
Bst2UI	CCWGG	1 cut(s)	74
Bst6I	CTCTTC	1 cut(s)	72
BstDEI	CTNAG	1 cut(s)	12
BstF5I	GGATG	1 cut(s)	217
BstKTI	GATC	2 cut(s)	107, 196
BstMBI	GATC	2 cut(s)	104, 193
BstNI	CCWGG	1 cut(s)	74
BstSCI	CCNGG	1 cut(s)	72
BstV1I	GCAGC	1 cut(s)	160
BsuRI	GGCC	1 cut(s)	260
BtsCI	GGATG	1 cut(s)	217
CviJI	RGCY	4 cut(s)	59, 82, 206, 260
CviKI_1	RGCY	4 cut(s)	59, 82, 206, 260
DdeI	CTNAG	1 cut(s)	12
DpnI	GATC	2 cut(s)	106, 195
DpnII	GATC	2 cut(s)	104, 193
DraI	TTTAAA	1 cut(s)	255
Eam1104I	CTCTTC	1 cut(s)	72
EarI	CTCTTC	1 cut(s)	72
Eco147I	AGGCCT	1 cut(s)	260
Eco32I	GATATC	1 cut(s)	91
EcoRII	CCWGG	1 cut(s)	72
EcoRV	GATATC	1 cut(s)	91
FaiI	YATR	1 cut(s)	165
FauI	CCCGC	1 cut(s)	133
Fnu4HI	GCNGC	1 cut(s)	174
FokI	GGATG	1 cut(s)	224
Fsp4HI	GCNGC	1 cut(s)	174
FspBI	CTAG	1 cut(s)	83
GluI	GCNGC	1 cut(s)	174
GsaI	CCCAGC	1 cut(s)	210
HaeIII	GGCC	1 cut(s)	260
Hpy166II	GTNNAC	1 cut(s)	200
Hpy188III	TCNNGA	1 cut(s)	197
Hpy8I	GTNNAC	1 cut(s)	200
HpyAV	CCTTC	2 cut(s)	42, 227
HpyCH4V	TGCA	1 cut(s)	4
HpyF3I	CTNAG	1 cut(s)	12
Kzo9I	GATC	2 cut(s)	104, 193
LguI	GCTCTTC	1 cut(s)	72
LpnPI	CCDG	3 cut(s)	59, 86, 192
Lsp1109I	GCAGC	1 cut(s)	160
LweI	GCATC	1 cut(s)	160
MaeI	CTAG	1 cut(s)	83
MalI	GATC	2 cut(s)	106, 195
MboI	GATC	2 cut(s)	104, 193
MboII	GAAGA	3 cut(s)	28, 89, 254
MluCI	AATT	1 cut(s)	156
MmeI	TCCRAC	2 cut(s)	25, 207
MnlI	CCTC	1 cut(s)	223
MseI	TTAA	3 cut(s)	53, 254, 264
MslI	CAYNNNNRTG	1 cut(s)	165
MspR9I	CCNGG	1 cut(s)	74
MvaI	CCWGG	1 cut(s)	74
NdeII	GATC	2 cut(s)	104, 193
PceI	AGGCCT	1 cut(s)	260
PciSI	GCTCTTC	1 cut(s)	72
PkrI	GCNGC	1 cut(s)	175
Psp6I	CCWGG	1 cut(s)	72
PspFI	CCCAGC	1 cut(s)	206
PspGI	CCWGG	1 cut(s)	72
RseI	CAYNNNNRTG	1 cut(s)	165
SapI	GCTCTTC	1 cut(s)	72
SaqAI	TTAA	3 cut(s)	53, 254, 264
SatI	GCNGC	1 cut(s)	174
Sau3AI	GATC	2 cut(s)	104, 193
ScrFI	CCNGG	1 cut(s)	74
SetI	ASST	3 cut(s)	53, 84, 208
SfaNI	GCATC	1 cut(s)	160
SmiMI	CAYNNNNRTG	1 cut(s)	165
Sse9I	AATT	1 cut(s)	156
SseBI	AGGCCT	1 cut(s)	260
SsiI	CCGC	1 cut(s)	140
SspMI	CTAG	1 cut(s)	83
StuI	AGGCCT	1 cut(s)	260
StyD4I	CCNGG	1 cut(s)	72
TaqI	TCGA	2 cut(s)	61, 97
TasI	AATT	1 cut(s)	156
Tru1I	TTAA	3 cut(s)	53, 254, 264
Tru9I	TTAA	3 cut(s)	53, 254, 264
TseI	GCWGC	1 cut(s)	173
TspDTI	ATGAA	4 cut(s)	141, 149, 150, 255
TspGWI	ACGGA	2 cut(s)	117, 213
XapI	RAATTY	1 cut(s)	156
XspI	CTAG	1 cut(s)	83

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.