Rroxscaffold_3G00247800
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001009
Physical Location & Seq
Forward (+)
41196491 .. 41196870
380 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00247800.1

Sequence Viewer

Length: 270 bp
ATGACACTTCTTTTAGGGCCACCTGGCTCTGGAAAGACCACGTTCTTATTGGCGTTGGCTGGAAAACTTGGTAAAGCTAATCTAAAATTTTCGGGGAGAGTTACATACAATGGAAGTGAGATAGATGAGTTTGTATCAGACAGGATGTCTGCTTATGTTACTCAACACGATCTAAATATTCCAGAACTGACAGTGAGAGAGACACTGGCTTTTGCAGCTAGATGTCAAGGTGTTGGACCACGTTATGGTATGTCTGTTAAAACACCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

89

Amino Acids

9.56

Weight (kDa)

9.3

Isoelectric Point (pI)

19.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ABC_tran PF00005 2 - 78 2.8e-08 ABC transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 245
AcsI RAATTY 1 cut(s) 86
AfiI CCNNNNNNNGG 2 cut(s) 29, 245
AhdI GACNNNNNGTC 1 cut(s) 145
AjnI CCWGG 1 cut(s) 22
AluBI AGCT 2 cut(s) 77, 218
AluI AGCT 2 cut(s) 77, 218
Alw26I GTCTC 1 cut(s) 194
AoxI GGCC 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 215
ApoI RAATTY 1 cut(s) 86
AspS9I GGNCC 2 cut(s) 17, 236
AvaII GGWCC 1 cut(s) 236
BbvI GCAGC 1 cut(s) 227
BciT130I CCWGG 1 cut(s) 24
BcoDI GTCTC 1 cut(s) 194
BfaI CTAG 1 cut(s) 219
BisI GCNGC 1 cut(s) 216
BlsI GCNGC 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 24
Bme18I GGWCC 1 cut(s) 236
BmeRI GACNNNNNGTC 1 cut(s) 145
BmgT120I GGNCC 2 cut(s) 17, 236
BmrFI CCNGG 1 cut(s) 24
Bsc4I CCNNNNNNNGG 2 cut(s) 29, 245
Bse1I ACTGG 1 cut(s) 210
BseBI CCWGG 1 cut(s) 24
BseGI GGATG 1 cut(s) 150
BseLI CCNNNNNNNGG 2 cut(s) 29, 245
BseNI ACTGG 1 cut(s) 210
BseXI GCAGC 1 cut(s) 227
BshFI GGCC 1 cut(s) 19
BslI CCNNNNNNNGG 2 cut(s) 29, 245
BsmAI GTCTC 1 cut(s) 194
BsnI GGCC 1 cut(s) 19
Bsp143I GATC 1 cut(s) 169
BspANI GGCC 1 cut(s) 19
BsrI ACTGG 1 cut(s) 210
BssMI GATC 1 cut(s) 169
Bst2UI CCWGG 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 193
BstF5I GGATG 1 cut(s) 150
BstKTI GATC 1 cut(s) 172
BstMAI GTCTC 1 cut(s) 194
BstMBI GATC 1 cut(s) 169
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNI CCWGG 1 cut(s) 24
BstSCI CCNGG 1 cut(s) 22
BstV1I GCAGC 1 cut(s) 227
BsuRI GGCC 1 cut(s) 19
BtsCI GGATG 1 cut(s) 150
BtsIMutI CAGTG 2 cut(s) 198, 203
Cfr13I GGNCC 2 cut(s) 17, 236
CviJI RGCY 6 cut(s) 19, 27, 59, 77, 209, 218
CviKI_1 RGCY 6 cut(s) 19, 27, 59, 77, 209, 218
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
DriI GACNNNNNGTC 1 cut(s) 145
Eam1105I GACNNNNNGTC 1 cut(s) 145
Eco47I GGWCC 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 22
FaiI YATR 4 cut(s) 106, 156, 246, 251
Fnu4HI GCNGC 1 cut(s) 216
FokI GGATG 1 cut(s) 157
Fsp4HI GCNGC 1 cut(s) 216
FspBI CTAG 1 cut(s) 219
GluI GCNGC 1 cut(s) 216
HaeIII GGCC 1 cut(s) 19
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 2 cut(s) 30, 182
HpyCH4III ACNGT 1 cut(s) 193
HpyCH4IV ACGT 2 cut(s) 41, 241
HpyCH4V TGCA 1 cut(s) 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpySE526I ACGT 2 cut(s) 41, 241
Kzo9I GATC 1 cut(s) 169
LpnPI CCDG 7 cut(s) 9, 15, 36, 45, 127, 191, 195
Lsp1109I GCAGC 1 cut(s) 227
MaeI CTAG 1 cut(s) 219
MaeII ACGT 2 cut(s) 41, 241
MaeIII GTNAC 2 cut(s) 100, 157
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MluCI AATT 1 cut(s) 86
MmeI TCCRAC 1 cut(s) 214
MseI TTAA 1 cut(s) 258
MspR9I CCNGG 1 cut(s) 24
MvaI CCWGG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 215
NdeII GATC 1 cut(s) 169
PflMI CCANNNNNTGG 1 cut(s) 245
PkrI GCNGC 1 cut(s) 217
Psp6I CCWGG 1 cut(s) 22
PspGI CCWGG 1 cut(s) 22
PspPI GGNCC 2 cut(s) 17, 236
SaqAI TTAA 1 cut(s) 258
SatI GCNGC 1 cut(s) 216
Sau3AI GATC 1 cut(s) 169
Sau96I GGNCC 2 cut(s) 17, 236
ScrFI CCNGG 1 cut(s) 24
SetI ASST 6 cut(s) 25, 44, 79, 220, 232, 244
SinI GGWCC 1 cut(s) 236
Sse9I AATT 1 cut(s) 86
SspI AATATT 1 cut(s) 178
SspMI CTAG 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 22
TaaI ACNGT 1 cut(s) 193
TaiI ACGT 2 cut(s) 44, 244
TasI AATT 1 cut(s) 86
Tru1I TTAA 1 cut(s) 258
Tru9I TTAA 1 cut(s) 258
TscAI CASTG 2 cut(s) 198, 210
TseI GCWGC 1 cut(s) 215
TspRI CASTG 2 cut(s) 198, 210
Van91I CCANNNNNTGG 1 cut(s) 245
VpaK11BI GGWCC 1 cut(s) 236
XapI RAATTY 1 cut(s) 86
XcmI CCANNNNNNNNNTGG 1 cut(s) 46
XspI CTAG 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.