Rroxscaffold_1G00034530

germin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000346
Physical Location & Seq
Forward (+)
50139384 .. 50144190
4807 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00034530.1

Sequence Viewer

Length: 177 bp
ATGGCCTCTACACTCAAATTCATCTCACTACTAATTTCTTCATTCGCCATAATTCAAATGGCATTGGCTGACCCGGATATTATTTCGGATTTCATTACACCTACTCCAAATGCAACAGAAAATCCAAACTACTTCACATTCCATTGTATGCAAGCTCCTAAGTTTATGGAGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cupin_1

Protein Analysis

58

Amino Acids

6.5

Weight (kDa)

4.36

Isoelectric Point (pI)

27.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000346)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g08590 FvH4_3g08600 FvH4_3g25280 FvH4_3g25310 FvH4_3g25320 FvH4_3g25340
malus_domestica MD03G1148000.v1.1 MD11G1166800.v1.1 MD11G1166900.v1.1 MD11G1167000.v1.1 MD11G1167300.v1.1 MD11G1167400.v1.1 MD11G1169200.v1.1 MD11G1169300.v1.1
prunus_persica Prupe.2G051900_v2.0.a1 Prupe.2G052000_v2.0.a1 Prupe.6G132900_v2.0.a1 Prupe.6G133000_v2.0.a1 Prupe.6G133100_v2.0.a1 Prupe.6G133200_v2.0.a1 Prupe.6G133300_v2.0.a1 Prupe.6G133400_v2.0.a1
pyrus_communis pycom02g19060 pycom11g13850 pycom11g13920 pycom11g13930 pycom13g26450
rosa_chinensis RchiOBHm_Chr5g0046741 RchiOBHm_Chr5g0046751 RchiOBHm_Chr5g0046771 RchiOBHm_Chr5g0046781 RchiOBHm_Chr5g0046791 RchiOBHm_Chr5g0046801 RchiOBHm_Chr5g0046811 RchiOBHm_Chr5g0046821
rosa_laevigata RLG00000029833 RLG00000029836 RLG00000034439 RLG00000034440 RLG00000034441 RLG00000034442 RLG00000034446 RLG00000034447 RLG00000034448 RLG00000034449 RLG00000034450
rosa_multiflora Rmu_co8272763.1_g000001 Rmu_co8405265.1_g000001 Rmu_sc0002264.1_g000001 Rmu_sc0002264.1_g000009 Rmu_sc0002264.1_g000010 Rmu_sc0002264.1_g000013 Rmu_sc0002264.1_g000024 Rmu_sc0004673.1_g000002 Rmu_sc0006050.1_g000018 Rmu_sc0006050.1_g000030 Rmu_sc0010683.1_g000003 Rmu_sc0010683.1_g000005 Rmu_sc0015021.1_g000001 Rmu_sc0019490.1_g000007 Rmu_sc0025079.1_g000001
rosa_roxburghii Rroxscaffold_1G00034530 Rroxscaffold_1G00034540 Rroxscaffold_1G00034550 Rroxscaffold_1G00034610 Rroxscaffold_1G00034620 Rroxscaffold_1G00034630
rosa_rugosa Rorug01G0085700 Rorug01G0085700 Rorug05G0231300 Rorug05G0231300 Rorug05G0231500 Rorug05G0231900 Rorug05G0232000 Rorug05G0232100 Rorug05G0232200
rosa_samantha Rh1AG104300 Rh1BG082600 Rh5AG311400 Rh5BG319600 Rh5BG319700 Rh5BG319800 Rh5BG319900 Rh5BG320100 Rh5BG320200 Rh5BG320400 Rh5CG345600 Rh5CG345700 Rh5CG345800 Rh5CG345900 Rh5CG346100 Rh5CG346400 Rh5CG346500 Rh5CG346600 Rh5DG330400 Rh5DG330500 Rh5DG330600 Rh5DG330700 Rh5DG330800 Rh5DG330900 Rh5DG331000 Rh5DG331100
rosa_wichuraiana Rw0G015910 Rw5G029040 Rw5G029050 Rw5G029060 Rw5G029070 Rw5G029100 Rw5G029110

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 17
AgsI TTSAA 1 cut(s) 56
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 17
AsuC2I CCSGG 1 cut(s) 74
BcnI CCSGG 1 cut(s) 74
BfaI CTAG 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 74
BmrFI CCNGG 1 cut(s) 74
BpuMI CCSGG 1 cut(s) 74
BsaXI ACNNNNNCTCC 2 cut(s) 88, 118
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 74
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 72
BsuRI GGCC 1 cut(s) 5
Cac8I GCNNGC 1 cut(s) 153
CviJI RGCY 3 cut(s) 5, 68, 155
CviKI_1 RGCY 3 cut(s) 5, 68, 155
DdeI CTNAG 1 cut(s) 159
FaiI YATR 3 cut(s) 50, 149, 167
FspBI CTAG 1 cut(s) 175
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 74
HpaII CCGG 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 88
HpyCH4V TGCA 2 cut(s) 113, 151
HpyF3I CTNAG 1 cut(s) 159
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 1 cut(s) 87
MaeI CTAG 1 cut(s) 175
MboII GAAGA 1 cut(s) 30
MluCI AATT 3 cut(s) 17, 33, 51
MnlI CCTC 2 cut(s) 16, 163
MspI CCGG 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 74
NciI CCSGG 1 cut(s) 74
ScrFI CCNGG 1 cut(s) 74
SetI ASST 2 cut(s) 103, 157
SgeI CNNG 3 cut(s) 85, 86, 164
Sse9I AATT 3 cut(s) 17, 33, 51
SspMI CTAG 1 cut(s) 175
StyD4I CCNGG 1 cut(s) 72
TasI AATT 3 cut(s) 17, 33, 51
TspDTI ATGAA 3 cut(s) 10, 30, 82
XapI RAATTY 1 cut(s) 17
XcmI CCANNNNNNNNNTGG 1 cut(s) 55
XspI CTAG 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.