Rh2CG355900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0000673
Physical Location & Seq
Forward (+)
48216493 .. 48222056
5564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG355900.1

Sequence Viewer

Length: 294 bp
ATGCTTTCTTCAATTCGTGGAGTTGATTGCATGATTCTTCTCATCTCAGCAATGATCTATAGAGTTGATATGATTTTCATAGATCACAATCCACCTGCAATTCAGAGCAGCAAAGATTTGGCGGTCTCCAACATGAAAGATGCAGCTTCTTGGTTGCCAAAGCATGAAACAAAAAATGTGAAACTCCTAAAAGTAAGAAGGCTCAAGTTGAGTGGTGATGAGGTTATTTATGCATTCTTCAGTTTGAAAGAAAGAATTGAGGTGAGGATATGGCACATTGAAGGTTTGGGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.11

Weight (kDa)

9.21

Isoelectric Point (pI)

46.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 103
Acc36I ACCTGC 1 cut(s) 103
AciI CCGC 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 223
AgsI TTSAA 3 cut(s) 12, 247, 281
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw26I GTCTC 1 cut(s) 130
ApeKI GCWGC 2 cut(s) 108, 143
AsuHPI GGTGA 2 cut(s) 227, 274
BbvI GCAGC 2 cut(s) 120, 155
BcoDI GTCTC 1 cut(s) 130
BfaI CTAG 1 cut(s) 292
BfmI CTRYAG 1 cut(s) 58
BfuAI ACCTGC 1 cut(s) 103
BisI GCNGC 2 cut(s) 109, 144
BlsI GCNGC 2 cut(s) 110, 145
BmsI GCATC 1 cut(s) 130
BpuEI CTTGAG 1 cut(s) 188
BsaBI GATNNNNATC 1 cut(s) 87
BsaI GGTCTC 1 cut(s) 130
Bse3DI GCAATG 1 cut(s) 57
Bse8I GATNNNNATC 1 cut(s) 87
BseJI GATNNNNATC 1 cut(s) 87
BseMI GCAATG 1 cut(s) 57
BseMII CTCAG 1 cut(s) 60
BseXI GCAGC 2 cut(s) 120, 155
BsmAI GTCTC 1 cut(s) 130
BsmI GAATGC 1 cut(s) 233
Bso31I GGTCTC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 54, 82
BspACI CCGC 1 cut(s) 122
BspCNI CTCAG 1 cut(s) 59
BspMI ACCTGC 1 cut(s) 103
BspTNI GGTCTC 1 cut(s) 130
BsrDI GCAATG 1 cut(s) 57
BssMI GATC 2 cut(s) 54, 82
BstDEI CTNAG 1 cut(s) 46
BstKTI GATC 2 cut(s) 57, 85
BstMAI GTCTC 1 cut(s) 130
BstMBI GATC 2 cut(s) 54, 82
BstSFI CTRYAG 1 cut(s) 58
BstV1I GCAGC 2 cut(s) 120, 155
BveI ACCTGC 1 cut(s) 103
CspCI CAANNNNNGTGG 2 cut(s) 193, 228
CviAII CATG 3 cut(s) 31, 133, 164
CviJI RGCY 3 cut(s) 146, 202, 291
CviKI_1 RGCY 3 cut(s) 146, 202, 291
DdeI CTNAG 1 cut(s) 46
DpnI GATC 2 cut(s) 56, 84
DpnII GATC 2 cut(s) 54, 82
Eco31I GGTCTC 1 cut(s) 130
Eco57I CTGAAG 1 cut(s) 223
EcoT22I ATGCAT 1 cut(s) 235
FaeI CATG 3 cut(s) 34, 136, 167
FaiI YATR 8 cut(s) 32, 60, 71, 80, 134, 165, 231, 271
FatI CATG 3 cut(s) 30, 132, 163
Fnu4HI GCNGC 2 cut(s) 109, 144
Fsp4HI GCNGC 2 cut(s) 109, 144
FspBI CTAG 1 cut(s) 292
GluI GCNGC 2 cut(s) 109, 144
Hin1II CATG 3 cut(s) 34, 136, 167
HinfI GANTC 1 cut(s) 34
HphI GGTGA 2 cut(s) 227, 274
Hpy188I TCNGA 1 cut(s) 105
HpyAV CCTTC 2 cut(s) 192, 275
HpyCH4V TGCA 4 cut(s) 30, 98, 143, 233
HpyF3I CTNAG 1 cut(s) 46
Hsp92II CATG 3 cut(s) 34, 136, 167
Kzo9I GATC 2 cut(s) 54, 82
LpnPI CCDG 1 cut(s) 108
Lsp1109I GCAGC 2 cut(s) 120, 155
LweI GCATC 1 cut(s) 130
MaeI CTAG 1 cut(s) 292
MalI GATC 2 cut(s) 56, 84
MboI GATC 2 cut(s) 54, 82
MboII GAAGA 2 cut(s) 29, 229
MluCI AATT 3 cut(s) 12, 99, 255
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 3 cut(s) 214, 253, 258
Mph1103I ATGCAT 1 cut(s) 235
Mva1269I GAATGC 1 cut(s) 233
NdeII GATC 2 cut(s) 54, 82
NlaIII CATG 3 cut(s) 34, 136, 167
NsiI ATGCAT 1 cut(s) 235
PaqCI CACCTGC 1 cut(s) 103
PctI GAATGC 1 cut(s) 233
PfeI GAWTC 1 cut(s) 34
PkrI GCNGC 2 cut(s) 110, 145
SatI GCNGC 2 cut(s) 109, 144
Sau3AI GATC 2 cut(s) 54, 82
SetI ASST 5 cut(s) 97, 148, 225, 264, 286
SfaNI GCATC 1 cut(s) 130
SfcI CTRYAG 1 cut(s) 58
SgeI CNNG 7 cut(s) 29, 43, 107, 145, 162, 176, 217
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 3 cut(s) 12, 99, 255
SsiI CCGC 1 cut(s) 122
SspMI CTAG 1 cut(s) 292
TasI AATT 3 cut(s) 12, 99, 255
TfiI GAWTC 1 cut(s) 34
TseI GCWGC 2 cut(s) 108, 143
TspDTI ATGAA 3 cut(s) 67, 149, 180
XspI CTAG 1 cut(s) 292
Zsp2I ATGCAT 1 cut(s) 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.