Prupe.8G029900_v2.0.a1

Ankyrin repeat-containing protein At3g12360-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0000724
Physical Location & Seq
Reverse (-)
2794259 .. 2795190
932 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G029900.1

Sequence Viewer

Length: 780 bp
ATGGAGGAGGCGAGCGATGCTGAGGTTGAAAGTATTGAAAGTAGAGGAAAGGCATTGAGTATCGCAAAAGAGCCATATGAATTTGCCATGAGCGGCAACTGGGAAGGCCTAAAAAAATTCCACAAGGAGGATGATAAGACGGAGGAAATACCCTTCGCCAAGCGGAACGTGCTTGAGTTTTTACTGAAGCTACTGATAAATGAATGTACTGAATCTAGTTTGTTATGCGCTGCGTTGAACGTGCAGAAAAACCGTGGCAACACCGTTTTTCATGAGGTGGCTGCGTCTGGAAATCTGGACGCAGCAAAGCATTTTTTGCAATTGGAAGACATAGTTCAGAGTAAGCCTGAATATCAATGTGTGCTAAAGATTGAGAACAAGTTAGGACAGACCCCACTCTACAGGGCAGCTGCTTTTCGTCAAATGAAAGTTGTTGAATATTTGGCTTCCGAAATGGAGGATATGGAGCTGCACTTCAAACGAAAGAGAGATAAAATATCCATTCTTCATATCGCAGTCATCGGCCAACATTTTGAGACTGCACTTTGGTTACTAAAAAAGCACCCATGTCTTGCGAACATAAAGGAAAGCAATGGCCTCACAAGTCTTCAATTGCTAGCCCAAATGCCATCTGCCTTTGGACCCAAATTTCGCAAAAGCATATGGACGATGCTCCTTTATAAATGTATTATCTACTCTGCTGCTTTTACACTACTACTAAAATTAGATATAATAAACTCAAAATTTCAATTTAGGAACAACCCATCTATTATTCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ank_2 PGG

Protein Analysis

260

Amino Acids

29.58

Weight (kDa)

8.18

Isoelectric Point (pI)

40.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000724)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g01330 FvH4_3g01340
malus_domestica MD05G1025600.v1.1 MD05G1025700.v1.1 MD05G1026000.v1.1 MD05G1353100.v1.1 MD05G1353500.v1.1 MD05G1353600.v1.1 MD05G1353800.v1.1 MD05G1354800.v1.1 MD09G1059700.v1.1 MD09G1059800.v1.1 MD10G1327600.v1.1 MD10G1327700.v1.1 MD10G1327800.v1.1
prunus_persica Prupe.4G014100_v2.0.a1 Prupe.4G014100_v2.0.a1 Prupe.4G014200_v2.0.a1 Prupe.4G014300_v2.0.a1 Prupe.4G014400_v2.0.a1 Prupe.7G089200_v2.0.a1 Prupe.8G021100_v2.0.a1 Prupe.8G029400_v2.0.a1 Prupe.8G029600_v2.0.a1 Prupe.8G029900_v2.0.a1 Prupe.8G030300_v2.0.a1
pyrus_communis pycom05g01740 pycom05g01780 pycom05g32030 pycom05g32040 pycom05g32050 pycom05g32070 pycom05g32080 pycom05g32090 pycom10g27710 pycom10g27740 pycom10g27760 pycom13g16890 pycom17g07270 pycom17g07280 pycom17g07290
rosa_chinensis RchiOBHm_Chr5g0001901 RchiOBHm_Chr5g0001921 RchiOBHm_Chr5g0001941
rosa_laevigata RLG00000030980 RLG00000030981 RLG00000030984
rosa_multiflora Rmu_sc0000378.1_g000012 Rmu_sc0000378.1_g000015 Rmu_sc0005788.1_g000001 Rmu_sc0006008.1_g000002
rosa_roxburghii Rroxscaffold_1G00071320 Rroxscaffold_1G00071340 Rroxscaffold_1G00071350 Rroxscaffold_1G00074390 Rroxscaffold_1G00074410 Rroxscaffold_1G00074460
rosa_rugosa Rorug04G0393700 Rorug04G0393800 Rorug04G0393900 Rorug04G0394000
rosa_samantha Rh5AG015000 Rh5BG018400 Rh5BG018500 Rh5BG018600 Rh5BG018700 Rh5CG016100 Rh5DG016600 Rh5DG016800 Rh5DG017000
rosa_wichuraiana Rw5G001450 Rw5G001460 Rw5G001480

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 681
AccBSI CCGCTC 1 cut(s) 93
AciI CCGC 2 cut(s) 93, 163
AcoI YGGCCR 1 cut(s) 523
AcsI RAATTY 4 cut(s) 80, 116, 647, 743
AcuI CTGAAG 1 cut(s) 206
AfaI GTAC 1 cut(s) 208
AfiI CCNNNNNNNGG 1 cut(s) 127
AgsI TTSAA 7 cut(s) 29, 38, 238, 437, 478, 611, 749
AluBI AGCT 3 cut(s) 190, 410, 469
AluI AGCT 3 cut(s) 190, 410, 469
Alw26I GTCTC 1 cut(s) 530
AoxI GGCC 3 cut(s) 106, 523, 595
ApeKI GCWGC 7 cut(s) 230, 281, 302, 407, 410, 469, 701
ApoI RAATTY 4 cut(s) 80, 116, 647, 743
ArsI GACNNNNNNTTYG 2 cut(s) 633, 665
AspLEI GCGC 1 cut(s) 230
AspS9I GGNCC 1 cut(s) 641
AsuNHI GCTAGC 1 cut(s) 616
AvaII GGWCC 1 cut(s) 641
BbsI GAAGAC 2 cut(s) 333, 599
BbvCI CCTCAGC 1 cut(s) 21
BbvI GCAGC 7 cut(s) 217, 268, 314, 397, 419, 456, 688
BccI CCATC 2 cut(s) 637, 772
BcoDI GTCTC 1 cut(s) 530
BfaI CTAG 2 cut(s) 216, 617
BfmI CTRYAG 1 cut(s) 400
BisI GCNGC 8 cut(s) 94, 231, 282, 303, 408, 411, 470, 702
BlsI GCNGC 8 cut(s) 95, 232, 283, 304, 409, 412, 471, 703
Bme18I GGWCC 1 cut(s) 641
BmgT120I GGNCC 1 cut(s) 641
BmiI GGNNCC 1 cut(s) 643
BmrI ACTGGG 1 cut(s) 109
BmsI GCATC 2 cut(s) 7, 660
BmtI GCTAGC 1 cut(s) 620
BmuI ACTGGG 1 cut(s) 109
BpiI GAAGAC 2 cut(s) 333, 599
Bpu10I CCTNAGC 1 cut(s) 21
BpuEI CTTGAG 1 cut(s) 194
BsaJI CCNNGG 1 cut(s) 253
Bsc4I CCNNNNNNNGG 1 cut(s) 127
Bse1I ACTGG 1 cut(s) 104
Bse3DI GCAATG 1 cut(s) 598
BseDI CCNNGG 1 cut(s) 253
BseGI GGATG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 127
BseMI GCAATG 1 cut(s) 598
BseMII CTCAG 1 cut(s) 12
BseNI ACTGG 1 cut(s) 104
BseRI GAGGAG 1 cut(s) 20
BseXI GCAGC 7 cut(s) 217, 268, 314, 397, 419, 456, 688
BsgI GTGCAG 3 cut(s) 263, 455, 525
BshFI GGCC 3 cut(s) 108, 525, 597
BslI CCNNNNNNNGG 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 530
BsnI GGCC 3 cut(s) 108, 525, 597
BspACI CCGC 2 cut(s) 93, 163
BspANI GGCC 3 cut(s) 108, 525, 597
BspCNI CTCAG 1 cut(s) 13
BspHI TCATGA 1 cut(s) 271
BspLI GGNNCC 1 cut(s) 643
BspOI GCTAGC 1 cut(s) 620
BsrBI CCGCTC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 598
BsrI ACTGG 1 cut(s) 104
BssECI CCNNGG 1 cut(s) 253
Bst4CI ACNGT 2 cut(s) 254, 265
BstAPI GCANNNNNTGC 1 cut(s) 316
BstC8I GCNNGC 2 cut(s) 13, 618
BstDEI CTNAG 1 cut(s) 21
BstDSI CCRYGG 1 cut(s) 253
BstF5I GGATG 1 cut(s) 136
BstHHI GCGC 1 cut(s) 230
BstMAI GTCTC 1 cut(s) 530
BstMWI GCNNNNNNNGC 3 cut(s) 17, 169, 316
BstSFI CTRYAG 1 cut(s) 400
BstV1I GCAGC 7 cut(s) 217, 268, 314, 397, 419, 456, 688
BstV2I GAAGAC 2 cut(s) 333, 599
BsuRI GGCC 3 cut(s) 108, 525, 597
BtgI CCRYGG 1 cut(s) 253
BtgZI GCGATG 1 cut(s) 30
BtsCI GGATG 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 13, 618
CciI TCATGA 1 cut(s) 271
CfoI GCGC 1 cut(s) 230
Cfr13I GGNCC 1 cut(s) 641
CseI GACGC 2 cut(s) 273, 308
Csp6I GTAC 1 cut(s) 207
CviAII CATG 3 cut(s) 88, 272, 567
CviQI GTAC 1 cut(s) 207
DdeI CTNAG 1 cut(s) 21
EaeI YGGCCR 1 cut(s) 523
Eco147I AGGCCT 1 cut(s) 108
Eco47I GGWCC 1 cut(s) 641
Eco57I CTGAAG 1 cut(s) 206
FaeI CATG 3 cut(s) 91, 275, 570
FatI CATG 3 cut(s) 87, 271, 566
FauNDI CATATG 2 cut(s) 76, 662
Fnu4HI GCNGC 8 cut(s) 94, 231, 282, 303, 408, 411, 470, 702
FokI GGATG 1 cut(s) 143
Fsp4HI GCNGC 8 cut(s) 94, 231, 282, 303, 408, 411, 470, 702
FspBI CTAG 2 cut(s) 216, 617
GlaI GCGC 1 cut(s) 229
GluI GCNGC 8 cut(s) 94, 231, 282, 303, 408, 411, 470, 702
HaeIII GGCC 3 cut(s) 108, 525, 597
HgaI GACGC 2 cut(s) 273, 308
HhaI GCGC 1 cut(s) 230
Hin1II CATG 3 cut(s) 91, 275, 570
Hin6I GCGC 1 cut(s) 228
HinP1I GCGC 1 cut(s) 228
HinfI GANTC 1 cut(s) 212
Hpy188I TCNGA 2 cut(s) 339, 451
Hpy188III TCNNGA 3 cut(s) 272, 288, 296
HpyAV CCTTC 2 cut(s) 98, 163
HpyCH4III ACNGT 2 cut(s) 254, 265
HpyCH4IV ACGT 2 cut(s) 168, 240
HpyCH4V TGCA 4 cut(s) 244, 319, 472, 542
HpyF10VI GCNNNNNNNGC 3 cut(s) 17, 169, 316
HpyF3I CTNAG 1 cut(s) 21
HpySE526I ACGT 2 cut(s) 168, 240
Hsp92II CATG 3 cut(s) 91, 275, 570
HspAI GCGC 1 cut(s) 228
LmnI GCTCC 2 cut(s) 466, 678
LpnPI CCDG 5 cut(s) 85, 273, 281, 360, 388
Lsp1109I GCAGC 7 cut(s) 217, 268, 314, 397, 419, 456, 688
LweI GCATC 2 cut(s) 7, 660
MaeI CTAG 2 cut(s) 216, 617
MaeII ACGT 2 cut(s) 168, 240
MaeIII GTNAC 1 cut(s) 549
MbiI CCGCTC 1 cut(s) 93
MboII GAAGA 3 cut(s) 338, 497, 599
MfeI CAATTG 2 cut(s) 320, 611
MluCI AATT 8 cut(s) 80, 116, 320, 611, 647, 722, 743, 749
MnlI CCTC 7 cut(s) 16, 38, 121, 136, 268, 451, 608
MspA1I CMGCKG 1 cut(s) 410
MunI CAATTG 2 cut(s) 320, 611
MwoI GCNNNNNNNGC 3 cut(s) 17, 169, 316
NdeI CATATG 2 cut(s) 76, 662
NheI GCTAGC 1 cut(s) 616
NlaIII CATG 3 cut(s) 91, 275, 570
NlaIV GGNNCC 1 cut(s) 643
PagI TCATGA 1 cut(s) 271
PceI AGGCCT 1 cut(s) 108
PfeI GAWTC 1 cut(s) 212
PkrI GCNGC 8 cut(s) 95, 232, 283, 304, 409, 412, 471, 703
PsiI TTATAA 1 cut(s) 681
PspN4I GGNNCC 1 cut(s) 643
PspPI GGNCC 1 cut(s) 641
PvuII CAGCTG 1 cut(s) 410
RsaI GTAC 1 cut(s) 208
RsaNI GTAC 1 cut(s) 207
SatI GCNGC 8 cut(s) 94, 231, 282, 303, 408, 411, 470, 702
Sau96I GGNCC 1 cut(s) 641
SetI ASST 7 cut(s) 27, 171, 192, 243, 279, 412, 471
SfaNI GCATC 2 cut(s) 7, 660
SfcI CTRYAG 1 cut(s) 400
SinI GGWCC 1 cut(s) 641
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 8 cut(s) 80, 116, 320, 611, 647, 722, 743, 749
SseBI AGGCCT 1 cut(s) 108
SsiI CCGC 2 cut(s) 93, 163
SspI AATATT 1 cut(s) 440
SspMI CTAG 2 cut(s) 216, 617
StuI AGGCCT 1 cut(s) 108
TaaI ACNGT 2 cut(s) 254, 265
TaiI ACGT 2 cut(s) 171, 243
TasI AATT 8 cut(s) 80, 116, 320, 611, 647, 722, 743, 749
TatI WGTACW 1 cut(s) 206
TauI GCSGC 1 cut(s) 96
TfiI GAWTC 1 cut(s) 212
TseI GCWGC 7 cut(s) 230, 281, 302, 407, 410, 469, 701
TspDTI ATGAA 5 cut(s) 93, 216, 260, 440, 497
TspGWI ACGGA 1 cut(s) 155
VpaK11BI GGWCC 1 cut(s) 641
XapI RAATTY 4 cut(s) 80, 116, 647, 743
XspI CTAG 2 cut(s) 216, 617
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.