pycom16g18750

gag-polypeptide of LTR copia-type

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
15458955 .. 15459516
562 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 522 bp
ATGGAAGATAAATTAATACCTCTCTATAAAGAATATGATTCGGCCAAAGAAATCATGGATGTACTTGAAAAGAAGTACGGCCCTAAATCTCAAACGTACATTCAGTTATTGCTTGAGAAATACAATGGGACAAAAATGGAGGAAACTGATTCTATGGTCGATCATATTACTAAAATGGAAGTAATGGCAAAAGACTTAGCCAATGTTGGCCATCCAGTTTCTGATAAAATGCAAGTTAGTGTTCTTCTTGGTAGCCTCCCAAATTCTTGGGAAAATGTAGTTACTTCCATGACTTATGGTCAAGTTAAATTAACGATGAACCCAAAGCTTGCAATGTTGGCTATTGAAGAAGTCAGTAAAAATTATAGGAAAAAGGAAAATGGACAAGGCAAAGCCAACCTCCTCATAGCGGAAGATTCTCTTAAAAAAACAAGCAACACATGCACAAGCCACATAGTAGTAACAAGTGCCCAAACTTCAAAAAGTTTGGACACCGCAAGTAGAACAAATTGGTCATTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

174

Amino Acids

19.4

Weight (kDa)

6.84

Isoelectric Point (pI)

26.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 1 - 120 3.4e-20 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000333)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G11910 AT3G11910 AT3G11910 AT3G11910 AT5G06600 AT5G06600 AT5G06600
fragaria_vesca FvH4_3g26930 FvH4_3g39132 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220
malus_domestica MD02G1261100.v1.1 MD03G1161100.v1.1 MD07G1059900.v1.1 MD11G1177100.v1.1 MD12G1047900.v1.1 MD12G1048000.v1.1 MD12G1048400.v1.1 MD12G1048500.v1.1 MD12G1048700.v1.1 MD12G1048800.v1.1 MD12G1056200.v1.1 MD14G1046300.v1.1 MD14G1046500.v1.1 MD15G1166900.v1.1
prunus_persica Prupe.2G066200_v2.0.a1 Prupe.2G066200_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1
pyrus_communis pycom02g22320 pycom03g11340 pycom07g04580 pycom11g14290 pycom11g15110 pycom12g04110 pycom12g04140 pycom12g04160 pycom12g04210 pycom12g04220 pycom12g04230 pycom12g04290 pycom12g04320 pycom12g04330 pycom12g04350 pycom12g04360 pycom14g03880 pycom14g03900 pycom16g18750
rosa_chinensis RchiOBHm_Chr1g0324111 RchiOBHm_Chr1g0324241 RchiOBHm_Chr3g0477691 RchiOBHm_Chr5g0049371 RchiOBHm_Chr5g0070531
rosa_laevigata RLG00000008612 RLG00000023698 RLG00000034613 RLG00000036139
rosa_multiflora Rmu_co8271779.1_g000001 Rmu_sc0006187.1_g000014
rosa_roxburghii Rroxscaffold_1G00010670 Rroxscaffold_1G00030450 Rroxscaffold_1G00031950 Rroxscaffold_1G00031970 Rroxscaffold_1G00032320 Rroxscaffold_1G00055490 Rroxscaffold_2G00083610 Rroxscaffold_2G00084480 Rroxscaffold_2G00115610 Rroxscaffold_3G00261320 Rroxscaffold_4G00312220 Rroxscaffold_4G00325820 Rroxscaffold_5G00339170 Rroxscaffold_5G00364030 Rroxscaffold_6G00403750
rosa_rugosa Rorug03G0162700 Rorug03G0162800 Rorug03G0162900 Rorug05G0247700 Rorug05G0406600 Rorug05G0406800
rosa_samantha Rh1AG060300 Rh3AG213000 Rh3BG246600 Rh3CG240400 Rh3DG239700 Rh5AG324400 Rh5AG462100 Rh5BG335500 Rh5BG480200 Rh5BG480300 Rh5CG360200 Rh5CG504500 Rh5CG504600 Rh5DG347800 Rh5DG492200 Rh5DG492300
rosa_wichuraiana Rw3G019270 Rw3G026910 Rw5G030650 Rw5G032610 Rw5G043040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 410, 495
AcoI YGGCCR 2 cut(s) 42, 208
AcsI RAATTY 1 cut(s) 262
AfaI GTAC 3 cut(s) 63, 77, 98
AfiI CCNNNNNNNGG 1 cut(s) 409
AgsI TTSAA 3 cut(s) 68, 347, 480
AhdI GACNNNNNGTC 1 cut(s) 297
AluBI AGCT 1 cut(s) 328
AluI AGCT 1 cut(s) 328
AlwNI CAGNNNCTG 1 cut(s) 221
AoxI GGCC 3 cut(s) 42, 79, 208
ApoI RAATTY 1 cut(s) 262
AseI ATTAAT 1 cut(s) 14
AspS9I GGNCC 1 cut(s) 80
BaeGI GKGCMC 1 cut(s) 472
BalI TGGCCA 1 cut(s) 210
BccI CCATC 1 cut(s) 219
BceAI ACGGC 1 cut(s) 94
BmeRI GACNNNNNGTC 1 cut(s) 297
BmgT120I GGNCC 1 cut(s) 80
BpuEI CTTGAG 1 cut(s) 134
Bsc4I CCNNNNNNNGG 1 cut(s) 409
Bse1I ACTGG 1 cut(s) 215
Bse3DI GCAATG 1 cut(s) 339
BseGI GGATG 2 cut(s) 64, 211
BseLI CCNNNNNNNGG 1 cut(s) 409
BseMI GCAATG 1 cut(s) 339
BseNI ACTGG 1 cut(s) 215
BseRI GAGGAG 1 cut(s) 392
BseSI GKGCMC 1 cut(s) 472
BshFI GGCC 3 cut(s) 44, 81, 210
BslFI GGGAC 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 409
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 3 cut(s) 44, 81, 210
Bsp1286I GDGCHC 1 cut(s) 472
Bsp143I GATC 1 cut(s) 160
BspACI CCGC 2 cut(s) 410, 495
BspANI GGCC 3 cut(s) 44, 81, 210
BsrDI GCAATG 1 cut(s) 339
BsrI ACTGG 1 cut(s) 215
BssMI GATC 1 cut(s) 160
BstAPI GCANNNNNTGC 1 cut(s) 441
BstC8I GCNNGC 1 cut(s) 330
BstDEI CTNAG 1 cut(s) 196
BstF5I GGATG 2 cut(s) 64, 211
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 2 cut(s) 338, 441
BstNSI RCATGY 1 cut(s) 444
BstSLI GKGCMC 1 cut(s) 472
BstXI CCANNNNNNTGG 1 cut(s) 267
BsuRI GGCC 3 cut(s) 44, 81, 210
BtsCI GGATG 2 cut(s) 64, 211
Cac8I GCNNGC 1 cut(s) 330
CaiI CAGNNNCTG 1 cut(s) 221
Cfr13I GGNCC 1 cut(s) 80
Csp6I GTAC 3 cut(s) 62, 76, 97
CviAII CATG 3 cut(s) 55, 289, 441
CviJI RGCY 9 cut(s) 44, 81, 200, 210, 255, 328, 341, 395, 450
CviKI_1 RGCY 9 cut(s) 44, 81, 200, 210, 255, 328, 341, 395, 450
CviQI GTAC 3 cut(s) 62, 76, 97
DdeI CTNAG 1 cut(s) 196
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
DriI GACNNNNNGTC 1 cut(s) 297
EaeI YGGCCR 2 cut(s) 42, 208
Eam1105I GACNNNNNGTC 1 cut(s) 297
FaeI CATG 3 cut(s) 58, 292, 444
FalI AAGNNNNNCTT 2 cut(s) 405, 437
FaqI GGGAC 1 cut(s) 142
FatI CATG 3 cut(s) 54, 288, 440
FokI GGATG 2 cut(s) 71, 198
HaeIII GGCC 3 cut(s) 44, 81, 210
Hin1II CATG 3 cut(s) 58, 292, 444
HindIII AAGCTT 1 cut(s) 326
HinfI GANTC 3 cut(s) 38, 149, 416
Hpy188I TCNGA 1 cut(s) 223
HpyCH4IV ACGT 1 cut(s) 95
HpyCH4V TGCA 3 cut(s) 232, 332, 444
HpyF10VI GCNNNNNNNGC 2 cut(s) 338, 441
HpyF3I CTNAG 1 cut(s) 196
HpySE526I ACGT 1 cut(s) 95
Hsp92II CATG 3 cut(s) 58, 292, 444
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 1 cut(s) 228
MaeII ACGT 1 cut(s) 95
MaeIII GTNAC 2 cut(s) 280, 460
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 4 cut(s) 17, 236, 359, 425
MhlI GDGCHC 1 cut(s) 472
MlsI TGGCCA 1 cut(s) 210
MluCI AATT 5 cut(s) 11, 262, 308, 361, 508
MluNI TGGCCA 1 cut(s) 210
MnlI CCTC 5 cut(s) 30, 133, 266, 410, 413
Mox20I TGGCCA 1 cut(s) 210
MscI TGGCCA 1 cut(s) 210
MseI TTAA 4 cut(s) 14, 306, 311, 423
Msp20I TGGCCA 1 cut(s) 210
MwoI GCNNNNNNNGC 2 cut(s) 338, 441
NdeII GATC 1 cut(s) 160
NlaIII CATG 3 cut(s) 58, 292, 444
NspI RCATGY 1 cut(s) 444
PfeI GAWTC 3 cut(s) 38, 149, 416
PshBI ATTAAT 1 cut(s) 14
PspPI GGNCC 1 cut(s) 80
PstNI CAGNNNCTG 1 cut(s) 221
RsaI GTAC 3 cut(s) 63, 77, 98
RsaNI GTAC 3 cut(s) 62, 76, 97
SaqAI TTAA 4 cut(s) 14, 306, 311, 423
Sau3AI GATC 1 cut(s) 160
Sau96I GGNCC 1 cut(s) 80
SduI GDGCHC 1 cut(s) 472
SetI ASST 4 cut(s) 22, 98, 330, 402
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
Sse9I AATT 5 cut(s) 11, 262, 308, 361, 508
SsiI CCGC 2 cut(s) 410, 495
TaiI ACGT 1 cut(s) 98
TaqI TCGA 1 cut(s) 159
TasI AATT 5 cut(s) 11, 262, 308, 361, 508
TatI WGTACW 1 cut(s) 61
TfiI GAWTC 3 cut(s) 38, 149, 416
Tru1I TTAA 4 cut(s) 14, 306, 311, 423
Tru9I TTAA 4 cut(s) 14, 306, 311, 423
TspDTI ATGAA 1 cut(s) 332
VspI ATTAAT 1 cut(s) 14
XapI RAATTY 1 cut(s) 262
XceI RCATGY 1 cut(s) 444
XcmI CCANNNNNNNNNTGG 1 cut(s) 52
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.