Rh1AG060300

Ubiquitin carboxyl-terminal hydrolase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
9892249 .. 9895825
3577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG060300.1

Sequence Viewer

Length: 261 bp
ATGGTTGCTAAGGAGTTTGGCATACCAGTTCAATTTCAGCGGTTTTGGCTGTGGGCGAAGTGTCAAAACCATACATATCGTCCAAACCGTCCGTTGATTCCCATGAAGGAAACACAACATGTTGGGCAGTTGAGGGAGGTATCAAATAAGGCTCATTACTTCATAATGCAGAACTCAAGTTGTTCTTGGATATTAGCTTGGAAGGGTAATATTGTCTTGCATCTAAAGACTGTAGCTAGAAAGATCTTTGCAGCTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

10.15

Weight (kDa)

10.3

Isoelectric Point (pI)

26.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
USP7_ICP0_bdg PF12436 13 - 50 2.2e-06 ICP0-binding domain of Ubiquitin-specific protease 7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000333)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G11910 AT3G11910 AT3G11910 AT3G11910 AT5G06600 AT5G06600 AT5G06600
fragaria_vesca FvH4_3g26930 FvH4_3g39132 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220
malus_domestica MD02G1261100.v1.1 MD03G1161100.v1.1 MD07G1059900.v1.1 MD11G1177100.v1.1 MD12G1047900.v1.1 MD12G1048000.v1.1 MD12G1048400.v1.1 MD12G1048500.v1.1 MD12G1048700.v1.1 MD12G1048800.v1.1 MD12G1056200.v1.1 MD14G1046300.v1.1 MD14G1046500.v1.1 MD15G1166900.v1.1
prunus_persica Prupe.2G066200_v2.0.a1 Prupe.2G066200_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1
pyrus_communis pycom02g22320 pycom03g11340 pycom07g04580 pycom11g14290 pycom11g15110 pycom12g04110 pycom12g04140 pycom12g04160 pycom12g04210 pycom12g04220 pycom12g04230 pycom12g04290 pycom12g04320 pycom12g04330 pycom12g04350 pycom12g04360 pycom14g03880 pycom14g03900 pycom16g18750
rosa_chinensis RchiOBHm_Chr1g0324111 RchiOBHm_Chr1g0324241 RchiOBHm_Chr3g0477691 RchiOBHm_Chr5g0049371 RchiOBHm_Chr5g0070531
rosa_laevigata RLG00000008612 RLG00000023698 RLG00000034613 RLG00000036139
rosa_multiflora Rmu_co8271779.1_g000001 Rmu_sc0006187.1_g000014
rosa_roxburghii Rroxscaffold_1G00010670 Rroxscaffold_1G00030450 Rroxscaffold_1G00031950 Rroxscaffold_1G00031970 Rroxscaffold_1G00032320 Rroxscaffold_1G00055490 Rroxscaffold_2G00083610 Rroxscaffold_2G00084480 Rroxscaffold_2G00115610 Rroxscaffold_3G00261320 Rroxscaffold_4G00312220 Rroxscaffold_4G00325820 Rroxscaffold_5G00339170 Rroxscaffold_5G00364030 Rroxscaffold_6G00403750
rosa_rugosa Rorug03G0162700 Rorug03G0162800 Rorug03G0162900 Rorug05G0247700 Rorug05G0406600 Rorug05G0406800
rosa_samantha Rh1AG060300 Rh3AG213000 Rh3BG246600 Rh3CG240400 Rh3DG239700 Rh5AG324400 Rh5AG462100 Rh5BG335500 Rh5BG480200 Rh5BG480300 Rh5CG360200 Rh5CG504500 Rh5CG504600 Rh5DG347800 Rh5DG492200 Rh5DG492300
rosa_wichuraiana Rw3G019270 Rw3G026910 Rw5G030650 Rw5G032610 Rw5G043040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AflIII ACRYGT 1 cut(s) 118
AgsI TTSAA 1 cut(s) 32
AluBI AGCT 3 cut(s) 197, 236, 254
AluI AGCT 3 cut(s) 197, 236, 254
ApeKI GCWGC 1 cut(s) 251
BfaI CTAG 1 cut(s) 237
BfmI CTRYAG 1 cut(s) 231
BglII AGATCT 1 cut(s) 243
BisI GCNGC 1 cut(s) 252
BlsI GCNGC 1 cut(s) 253
BmsI GCATC 1 cut(s) 229
Bpu10I CCTNAGC 1 cut(s) 9
BpuEI CTTGAG 1 cut(s) 160
Bse1I ACTGG 1 cut(s) 26
BseNI ACTGG 1 cut(s) 26
Bsp143I GATC 1 cut(s) 243
BspACI CCGC 1 cut(s) 40
BsrI ACTGG 1 cut(s) 26
BssMI GATC 1 cut(s) 243
Bst4CI ACNGT 2 cut(s) 89, 232
BstDEI CTNAG 1 cut(s) 9
BstKTI GATC 1 cut(s) 246
BstMBI GATC 1 cut(s) 243
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstNSI RCATGY 1 cut(s) 122
BstSFI CTRYAG 1 cut(s) 231
BstX2I RGATCY 1 cut(s) 243
BstYI RGATCY 1 cut(s) 243
CviAII CATG 2 cut(s) 103, 119
CviJI RGCY 5 cut(s) 49, 152, 197, 236, 254
CviKI_1 RGCY 5 cut(s) 49, 152, 197, 236, 254
DdeI CTNAG 1 cut(s) 9
DpnI GATC 1 cut(s) 245
DpnII GATC 1 cut(s) 243
FaeI CATG 2 cut(s) 106, 122
FaiI YATR 6 cut(s) 23, 72, 76, 104, 120, 164
FalI AAGNNNNNCTT 2 cut(s) 169, 201
FatI CATG 2 cut(s) 102, 118
Fnu4HI GCNGC 1 cut(s) 252
Fsp4HI GCNGC 1 cut(s) 252
FspBI CTAG 1 cut(s) 237
GluI GCNGC 1 cut(s) 252
Hin1II CATG 2 cut(s) 106, 122
HinfI GANTC 1 cut(s) 97
HpyAV CCTTC 2 cut(s) 100, 196
HpyCH4III ACNGT 2 cut(s) 89, 232
HpyCH4V TGCA 3 cut(s) 169, 220, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpyF3I CTNAG 1 cut(s) 9
Hsp92II CATG 2 cut(s) 106, 122
Kzo9I GATC 1 cut(s) 243
LpnPI CCDG 1 cut(s) 39
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 237
MalI GATC 1 cut(s) 245
MboI GATC 1 cut(s) 243
MflI RGATCY 1 cut(s) 243
MluCI AATT 1 cut(s) 32
MnlI CCTC 2 cut(s) 126, 130
MseI TTAA 1 cut(s) 259
MspA1I CMGCKG 1 cut(s) 40
MwoI GCNNNNNNNGC 1 cut(s) 46
NdeII GATC 1 cut(s) 243
NlaIII CATG 2 cut(s) 106, 122
NspI RCATGY 1 cut(s) 122
PciI ACATGT 1 cut(s) 118
PcsI WCGNNNNNNNCGW 1 cut(s) 85
PfeI GAWTC 1 cut(s) 97
PkrI GCNGC 1 cut(s) 253
PscI ACATGT 1 cut(s) 118
PsuI RGATCY 1 cut(s) 243
SaqAI TTAA 1 cut(s) 259
SatI GCNGC 1 cut(s) 252
Sau3AI GATC 1 cut(s) 243
SetI ASST 4 cut(s) 141, 199, 238, 256
SfaNI GCATC 1 cut(s) 229
SfcI CTRYAG 1 cut(s) 231
SgeI CNNG 8 cut(s) 38, 115, 131, 189, 198, 210, 229, 249
SmlI CTYRAG 1 cut(s) 175
SmoI CTYRAG 1 cut(s) 175
Sse9I AATT 1 cut(s) 32
SsiI CCGC 1 cut(s) 40
SspI AATATT 1 cut(s) 211
SspMI CTAG 1 cut(s) 237
TaaI ACNGT 2 cut(s) 89, 232
TasI AATT 1 cut(s) 32
TfiI GAWTC 1 cut(s) 97
Tru1I TTAA 1 cut(s) 259
Tru9I TTAA 1 cut(s) 259
TseI GCWGC 1 cut(s) 251
TspDTI ATGAA 2 cut(s) 119, 151
TspGWI ACGGA 1 cut(s) 81
XceI RCATGY 1 cut(s) 122
XspI CTAG 1 cut(s) 237
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.