Rmu_co8271779.1_g000001

Ubiquitin carboxyl-terminal hydrolase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8271779.1
OG0000333
Physical Location & Seq
Forward (+)
1 .. 648
648 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8271779.1_g000001.1.cds

Sequence Viewer

Length: 300 bp
gttgggcagttgagggaggtatcaaacaaggttcataatgcagaactgaagttgttcttggaaatagagcttggaccggatttacaccctattgctccacctgacaagacaaaggatgatattctgcttttctttaagctttatgatcctgaaaaagaagaactacgttatgttggacggctttttgtgaagagtactggtaagccagctgaaatcttgtcaaaattaaatgaattggctggctatgcccctgacgaggagatcgacctttacgaggtttgcatccagcaacattcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04068 ko05168 ko05169 ko05203 map04068 map05168 map05169 map05203
Pfam Domains
Protein Families
MATH UCH USP7_C2 USP7_ICP0_bdg

Protein Analysis

99

Amino Acids

11.32

Weight (kDa)

4.88

Isoelectric Point (pI)

39.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000333)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G11910 AT3G11910 AT3G11910 AT3G11910 AT5G06600 AT5G06600 AT5G06600
fragaria_vesca FvH4_3g26930 FvH4_3g39132 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220
malus_domestica MD02G1261100.v1.1 MD03G1161100.v1.1 MD07G1059900.v1.1 MD11G1177100.v1.1 MD12G1047900.v1.1 MD12G1048000.v1.1 MD12G1048400.v1.1 MD12G1048500.v1.1 MD12G1048700.v1.1 MD12G1048800.v1.1 MD12G1056200.v1.1 MD14G1046300.v1.1 MD14G1046500.v1.1 MD15G1166900.v1.1
prunus_persica Prupe.2G066200_v2.0.a1 Prupe.2G066200_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1
pyrus_communis pycom02g22320 pycom03g11340 pycom07g04580 pycom11g14290 pycom11g15110 pycom12g04110 pycom12g04140 pycom12g04160 pycom12g04210 pycom12g04220 pycom12g04230 pycom12g04290 pycom12g04320 pycom12g04330 pycom12g04350 pycom12g04360 pycom14g03880 pycom14g03900 pycom16g18750
rosa_chinensis RchiOBHm_Chr1g0324111 RchiOBHm_Chr1g0324241 RchiOBHm_Chr3g0477691 RchiOBHm_Chr5g0049371 RchiOBHm_Chr5g0070531
rosa_laevigata RLG00000008612 RLG00000023698 RLG00000034613 RLG00000036139
rosa_multiflora Rmu_co8271779.1_g000001 Rmu_sc0006187.1_g000014
rosa_roxburghii Rroxscaffold_1G00010670 Rroxscaffold_1G00030450 Rroxscaffold_1G00031950 Rroxscaffold_1G00031970 Rroxscaffold_1G00032320 Rroxscaffold_1G00055490 Rroxscaffold_2G00083610 Rroxscaffold_2G00084480 Rroxscaffold_2G00115610 Rroxscaffold_3G00261320 Rroxscaffold_4G00312220 Rroxscaffold_4G00325820 Rroxscaffold_5G00339170 Rroxscaffold_5G00364030 Rroxscaffold_6G00403750
rosa_rugosa Rorug03G0162700 Rorug03G0162800 Rorug03G0162900 Rorug05G0247700 Rorug05G0406600 Rorug05G0406800
rosa_samantha Rh1AG060300 Rh3AG213000 Rh3BG246600 Rh3CG240400 Rh3DG239700 Rh5AG324400 Rh5AG462100 Rh5BG335500 Rh5BG480200 Rh5BG480300 Rh5CG360200 Rh5CG504500 Rh5CG504600 Rh5DG347800 Rh5DG492200 Rh5DG492300
rosa_wichuraiana Rw3G019270 Rw3G026910 Rw5G030650 Rw5G032610 Rw5G043040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 68
AfaI GTAC 1 cut(s) 196
AfiI CCNNNNNNNGG 2 cut(s) 256, 274
AjuI GAANNNNNNNTTGG 4 cut(s) 41, 54, 73, 86
AluBI AGCT 3 cut(s) 70, 139, 209
AluI AGCT 3 cut(s) 70, 139, 209
AlwI GGATC 1 cut(s) 140
Asp700I GAANNNNTTC 1 cut(s) 53
AspS9I GGNCC 1 cut(s) 74
AvaII GGWCC 1 cut(s) 74
BceAI ACGGC 1 cut(s) 194
BmcAI AGTACT 1 cut(s) 196
Bme18I GGWCC 1 cut(s) 74
BmgT120I GGNCC 1 cut(s) 74
BmsI GCATC 1 cut(s) 291
BsaWI WCCGGW 1 cut(s) 76
Bsc4I CCNNNNNNNGG 2 cut(s) 256, 274
Bse1I ACTGG 1 cut(s) 202
BseGI GGATG 2 cut(s) 121, 282
BseLI CCNNNNNNNGG 2 cut(s) 256, 274
BseNI ACTGG 1 cut(s) 202
BseRI GAGGAG 1 cut(s) 272
BsiSI CCGG 1 cut(s) 77
BslI CCNNNNNNNGG 2 cut(s) 256, 274
Bsp143I GATC 2 cut(s) 145, 261
BspPI GGATC 1 cut(s) 140
BsrI ACTGG 1 cut(s) 202
BssMI GATC 2 cut(s) 145, 261
Bst6I CTCTTC 1 cut(s) 185
BstC8I GCNNGC 2 cut(s) 207, 241
BstENI CCTNNNNNAGG 1 cut(s) 272
BstF5I GGATG 2 cut(s) 121, 282
BstKTI GATC 2 cut(s) 148, 264
BstMBI GATC 2 cut(s) 145, 261
BstMWI GCNNNNNNNGC 1 cut(s) 245
BtsCI GGATG 2 cut(s) 121, 282
Cac8I GCNNGC 2 cut(s) 207, 241
Cfr13I GGNCC 1 cut(s) 74
Csp6I GTAC 1 cut(s) 195
CviJI RGCY 7 cut(s) 70, 139, 181, 205, 209, 239, 243
CviKI_1 RGCY 7 cut(s) 70, 139, 181, 205, 209, 239, 243
CviQI GTAC 1 cut(s) 195
DpnI GATC 2 cut(s) 147, 263
DpnII GATC 2 cut(s) 145, 261
Eam1104I CTCTTC 1 cut(s) 185
EarI CTCTTC 1 cut(s) 185
Eco47I GGWCC 1 cut(s) 74
Eco57I CTGAAG 1 cut(s) 68
EcoNI CCTNNNNNAGG 1 cut(s) 272
FaiI YATR 4 cut(s) 36, 144, 171, 246
FalI AAGNNNNNCTT 2 cut(s) 41, 73
FokI GGATG 2 cut(s) 128, 269
HapII CCGG 1 cut(s) 77
HindIII AAGCTT 1 cut(s) 137
HpaII CCGG 1 cut(s) 77
Hpy188III TCNNGA 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 166
HpyCH4V TGCA 2 cut(s) 41, 282
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpySE526I ACGT 1 cut(s) 166
Kzo9I GATC 2 cut(s) 145, 261
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 7 cut(s) 90, 114, 162, 183, 219, 225, 264
LweI GCATC 1 cut(s) 291
MaeII ACGT 1 cut(s) 166
MalI GATC 2 cut(s) 147, 263
MboI GATC 2 cut(s) 145, 261
MboII GAAGA 2 cut(s) 170, 202
MluCI AATT 2 cut(s) 224, 233
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 4 cut(s) 6, 10, 250, 268
MroXI GAANNNNTTC 1 cut(s) 53
MseI TTAA 3 cut(s) 135, 227, 298
MspA1I CMGCKG 1 cut(s) 209
MspI CCGG 1 cut(s) 77
MwoI GCNNNNNNNGC 1 cut(s) 245
NdeII GATC 2 cut(s) 145, 261
PcsI WCGNNNNNNNCGW 2 cut(s) 261, 270
PdmI GAANNNNTTC 1 cut(s) 53
PspPI GGNCC 1 cut(s) 74
PvuII CAGCTG 1 cut(s) 209
RsaI GTAC 1 cut(s) 196
RsaNI GTAC 1 cut(s) 195
SaqAI TTAA 3 cut(s) 135, 227, 298
Sau3AI GATC 2 cut(s) 145, 261
Sau96I GGNCC 1 cut(s) 74
ScaI AGTACT 1 cut(s) 196
SetI ASST 9 cut(s) 21, 33, 72, 103, 141, 169, 211, 270, 279
SfaNI GCATC 1 cut(s) 291
SinI GGWCC 1 cut(s) 74
Sse9I AATT 2 cut(s) 224, 233
TaiI ACGT 1 cut(s) 169
TaqI TCGA 1 cut(s) 264
TasI AATT 2 cut(s) 224, 233
TatI WGTACW 1 cut(s) 194
Tru1I TTAA 3 cut(s) 135, 227, 298
Tru9I TTAA 3 cut(s) 135, 227, 298
TspDTI ATGAA 2 cut(s) 23, 246
VpaK11BI GGWCC 1 cut(s) 74
XagI CCTNNNNNAGG 1 cut(s) 272
XmnI GAANNNNTTC 1 cut(s) 53
ZrmI AGTACT 1 cut(s) 196
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.