Rw3G026910

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0000333
Physical Location & Seq
Reverse (-)
37342267 .. 37343953
1687 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G026910.1

Sequence Viewer

Length: 606 bp
ATGGCCAGTAAATGCAAAGCAGGAAATACAAAGATAGAGAGGCTCAATAATATCAATCATCGCATATGGAAAAGAAGAATCACCTATCTACTTACCCATGAGAAAACGTTATATACGTTAAAAACTGAGAGGCTTCCCGTCGCATCTCGGAATTATATTAAATGGGAAGAAGATAATGCATTAGCTATTGCTACGATTCTCAATCATATGGAAGATGATTTGATTCCTCTCTATGAAGGATATGAGACCGCCAAAGAAATCATGAATGTGTTGGATGAAAAATATGGGCCTAAATCTCAAATATACATTCAATTGTTGCTTGAGAAATATAACAACACTCGTATGAACGAAAATGATGATATGGTGGATCATATTACCAAAATGGAGGTATTAGCAAAGGACTTGTCTAATGCTGGTCATCCTATTCCTAATCAAATGCAAGTTTCTACACTTCTCAACAGTCTTCCCAAATCATGGGATCATGTGGTGACTTCTTTGACCTATGGTAAAAAAGAGTTGTCCATGAATAATTTGCCTGCTATGTTAGCAGTTGAAGAAGTGGTGAATATGAAGCCTTTGATAAATTCTGCAAAGAACATGGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2

Protein Analysis

201

Amino Acids

23.17

Weight (kDa)

7.02

Isoelectric Point (pI)

30.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotran_gag_2 PF14223 34 - 186 5.6e-26 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000333)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G11910 AT3G11910 AT3G11910 AT3G11910 AT5G06600 AT5G06600 AT5G06600
fragaria_vesca FvH4_3g26930 FvH4_3g39132 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220
malus_domestica MD02G1261100.v1.1 MD03G1161100.v1.1 MD07G1059900.v1.1 MD11G1177100.v1.1 MD12G1047900.v1.1 MD12G1048000.v1.1 MD12G1048400.v1.1 MD12G1048500.v1.1 MD12G1048700.v1.1 MD12G1048800.v1.1 MD12G1056200.v1.1 MD14G1046300.v1.1 MD14G1046500.v1.1 MD15G1166900.v1.1
prunus_persica Prupe.2G066200_v2.0.a1 Prupe.2G066200_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1
pyrus_communis pycom02g22320 pycom03g11340 pycom07g04580 pycom11g14290 pycom11g15110 pycom12g04110 pycom12g04140 pycom12g04160 pycom12g04210 pycom12g04220 pycom12g04230 pycom12g04290 pycom12g04320 pycom12g04330 pycom12g04350 pycom12g04360 pycom14g03880 pycom14g03900 pycom16g18750
rosa_chinensis RchiOBHm_Chr1g0324111 RchiOBHm_Chr1g0324241 RchiOBHm_Chr3g0477691 RchiOBHm_Chr5g0049371 RchiOBHm_Chr5g0070531
rosa_laevigata RLG00000008612 RLG00000023698 RLG00000034613 RLG00000036139
rosa_multiflora Rmu_co8271779.1_g000001 Rmu_sc0006187.1_g000014
rosa_roxburghii Rroxscaffold_1G00010670 Rroxscaffold_1G00030450 Rroxscaffold_1G00031950 Rroxscaffold_1G00031970 Rroxscaffold_1G00032320 Rroxscaffold_1G00055490 Rroxscaffold_2G00083610 Rroxscaffold_2G00084480 Rroxscaffold_2G00115610 Rroxscaffold_3G00261320 Rroxscaffold_4G00312220 Rroxscaffold_4G00325820 Rroxscaffold_5G00339170 Rroxscaffold_5G00364030 Rroxscaffold_6G00403750
rosa_rugosa Rorug03G0162700 Rorug03G0162800 Rorug03G0162900 Rorug05G0247700 Rorug05G0406600 Rorug05G0406800
rosa_samantha Rh1AG060300 Rh3AG213000 Rh3BG246600 Rh3CG240400 Rh3DG239700 Rh5AG324400 Rh5AG462100 Rh5BG335500 Rh5BG480200 Rh5BG480300 Rh5CG360200 Rh5CG504500 Rh5CG504600 Rh5DG347800 Rh5DG492200 Rh5DG492300
rosa_wichuraiana Rw3G019270 Rw3G026910 Rw5G030650 Rw5G032610 Rw5G043040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 474
AciI CCGC 1 cut(s) 249
AclI AACGTT 1 cut(s) 107
AclWI GGATC 2 cut(s) 375, 486
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 583
AfiI CCNNNNNNNGG 1 cut(s) 474
AgsI TTSAA 2 cut(s) 311, 554
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
Alw26I GTCTC 1 cut(s) 239
AlwI GGATC 2 cut(s) 375, 486
AoxI GGCC 2 cut(s) 3, 287
ApoI RAATTY 1 cut(s) 583
ArsI GACNNNNNNTTYG 2 cut(s) 389, 421
AspS9I GGNCC 1 cut(s) 287
AsuHPI GGTGA 3 cut(s) 73, 499, 574
BalI TGGCCA 1 cut(s) 5
BbsI GAAGAC 1 cut(s) 455
BcoDI GTCTC 1 cut(s) 239
BmgT120I GGNCC 1 cut(s) 287
BmsI GCATC 1 cut(s) 152
BpiI GAAGAC 1 cut(s) 455
BpuEI CTTGAG 1 cut(s) 341
BsaI GGTCTC 1 cut(s) 239
Bsc4I CCNNNNNNNGG 1 cut(s) 474
Bse1I ACTGG 1 cut(s) 6
BseGI GGATG 2 cut(s) 280, 418
BseLI CCNNNNNNNGG 1 cut(s) 474
BseMII CTCAG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 6
BshFI GGCC 2 cut(s) 5, 289
BslI CCNNNNNNNGG 1 cut(s) 474
BsmAI GTCTC 1 cut(s) 239
BsnI GGCC 2 cut(s) 5, 289
Bso31I GGTCTC 1 cut(s) 239
Bsp143I GATC 2 cut(s) 367, 478
BspACI CCGC 1 cut(s) 249
BspANI GGCC 2 cut(s) 5, 289
BspCNI CTCAG 1 cut(s) 118
BspHI TCATGA 1 cut(s) 261
BspPI GGATC 2 cut(s) 375, 486
BspTNI GGTCTC 1 cut(s) 239
BsrI ACTGG 1 cut(s) 6
BssMI GATC 2 cut(s) 367, 478
Bst4CI ACNGT 1 cut(s) 461
BstC8I GCNNGC 1 cut(s) 537
BstDEI CTNAG 1 cut(s) 126
BstF5I GGATG 2 cut(s) 280, 418
BstKTI GATC 2 cut(s) 370, 481
BstMAI GTCTC 1 cut(s) 239
BstMBI GATC 2 cut(s) 367, 478
BstMWI GCNNNNNNNGC 1 cut(s) 545
BstV2I GAAGAC 1 cut(s) 455
BsuRI GGCC 2 cut(s) 5, 289
BtgZI GCGATG 1 cut(s) 44
BtsCI GGATG 2 cut(s) 280, 418
Cac8I GCNNGC 1 cut(s) 537
CciI TCATGA 1 cut(s) 261
Cfr13I GGNCC 1 cut(s) 287
CviAII CATG 6 cut(s) 98, 262, 474, 482, 523, 598
CviJI RGCY 6 cut(s) 5, 43, 133, 185, 289, 574
CviKI_1 RGCY 6 cut(s) 5, 43, 133, 185, 289, 574
DdeI CTNAG 1 cut(s) 126
DpnI GATC 2 cut(s) 369, 480
DpnII GATC 2 cut(s) 367, 478
EaeI YGGCCR 1 cut(s) 3
Eco31I GGTCTC 1 cut(s) 239
EcoT22I ATGCAT 1 cut(s) 181
FaeI CATG 6 cut(s) 101, 265, 477, 485, 526, 601
FatI CATG 6 cut(s) 97, 261, 473, 481, 522, 597
FauNDI CATATG 2 cut(s) 65, 207
FokI GGATG 2 cut(s) 287, 405
HaeIII GGCC 2 cut(s) 5, 289
Hin1II CATG 6 cut(s) 101, 265, 477, 485, 526, 601
HinfI GANTC 3 cut(s) 78, 196, 223
HphI GGTGA 3 cut(s) 73, 499, 574
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 262
Hpy99I CGWCG 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 230
HpyCH4III ACNGT 1 cut(s) 461
HpyCH4IV ACGT 2 cut(s) 107, 116
HpyCH4V TGCA 4 cut(s) 15, 179, 439, 590
HpyF10VI GCNNNNNNNGC 1 cut(s) 545
HpyF3I CTNAG 1 cut(s) 126
HpySE526I ACGT 2 cut(s) 107, 116
Hsp92II CATG 6 cut(s) 101, 265, 477, 485, 526, 601
Kzo9I GATC 2 cut(s) 367, 478
LpnPI CCDG 4 cut(s) 6, 19, 399, 549
LweI GCATC 1 cut(s) 152
MaeII ACGT 2 cut(s) 107, 116
MaeIII GTNAC 1 cut(s) 487
MalI GATC 2 cut(s) 369, 480
MboI GATC 2 cut(s) 367, 478
MboII GAAGA 6 cut(s) 87, 179, 182, 224, 455, 566
MfeI CAATTG 1 cut(s) 311
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 4 cut(s) 151, 311, 529, 583
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 252
MnlI CCTC 4 cut(s) 33, 123, 237, 379
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 1 cut(s) 181
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 119, 159
MslI CAYNNNNRTG 2 cut(s) 266, 341
Msp20I TGGCCA 1 cut(s) 5
MunI CAATTG 1 cut(s) 311
MwoI GCNNNNNNNGC 1 cut(s) 545
NdeI CATATG 2 cut(s) 65, 207
NdeII GATC 2 cut(s) 367, 478
NlaIII CATG 6 cut(s) 101, 265, 477, 485, 526, 601
NmuCI GTSAC 1 cut(s) 487
NsiI ATGCAT 1 cut(s) 181
PagI TCATGA 1 cut(s) 261
PcsI WCGNNNNNNNCGW 1 cut(s) 113
PfeI GAWTC 3 cut(s) 78, 196, 223
PflMI CCANNNNNTGG 1 cut(s) 474
Psp1406I AACGTT 1 cut(s) 107
PspPI GGNCC 1 cut(s) 287
RseI CAYNNNNRTG 2 cut(s) 266, 341
SaqAI TTAA 2 cut(s) 119, 159
Sau3AI GATC 2 cut(s) 367, 478
Sau96I GGNCC 1 cut(s) 287
SetI ASST 6 cut(s) 86, 110, 119, 187, 390, 503
SfaNI GCATC 1 cut(s) 152
SmiMI CAYNNNNRTG 2 cut(s) 266, 341
SmlI CTYRAG 1 cut(s) 320
SmoI CTYRAG 1 cut(s) 320
Sse9I AATT 4 cut(s) 151, 311, 529, 583
SsiI CCGC 1 cut(s) 249
TaaI ACNGT 1 cut(s) 461
TaiI ACGT 2 cut(s) 110, 119
TasI AATT 4 cut(s) 151, 311, 529, 583
TfiI GAWTC 3 cut(s) 78, 196, 223
Tru1I TTAA 2 cut(s) 119, 159
Tru9I TTAA 2 cut(s) 119, 159
TseFI GTSAC 1 cut(s) 487
Tsp45I GTSAC 1 cut(s) 487
TspDTI ATGAA 6 cut(s) 249, 278, 291, 359, 539, 584
Van91I CCANNNNNTGG 1 cut(s) 474
XapI RAATTY 1 cut(s) 583
Zsp2I ATGCAT 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.