RchiOBHm_Chr1g0324241

Ubiquitin carboxyl-terminal hydrolase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
11923569 .. 11926206
2638 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55408

Sequence Viewer

Length: 195 bp
ATGGTTGCTAAGGAGTTTGGCATACCAGTTCAATTTCAGCGGTTTTGGCTGTGGGCTAAGTGTCAAAACCATACATATCGTCCAAACCGTCCGTTGATTCCCATGAAGGAACCACAACATGTTGGGCAGTTGAGGGAGGTATCAAATAAGGCTCATTACTTCATAATGCAGAACCCAAGTTGTTCTTGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.73

Weight (kDa)

9.92

Isoelectric Point (pI)

35.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
USP7_ICP0_bdg PF12436 13 - 49 5.1e-06 ICP0-binding domain of Ubiquitin-specific protease 7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000333)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G11910 AT3G11910 AT3G11910 AT3G11910 AT5G06600 AT5G06600 AT5G06600
fragaria_vesca FvH4_3g26930 FvH4_3g39132 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220 FvH4_6g21220
malus_domestica MD02G1261100.v1.1 MD03G1161100.v1.1 MD07G1059900.v1.1 MD11G1177100.v1.1 MD12G1047900.v1.1 MD12G1048000.v1.1 MD12G1048400.v1.1 MD12G1048500.v1.1 MD12G1048700.v1.1 MD12G1048800.v1.1 MD12G1056200.v1.1 MD14G1046300.v1.1 MD14G1046500.v1.1 MD15G1166900.v1.1
prunus_persica Prupe.2G066200_v2.0.a1 Prupe.2G066200_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.6G149500_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1 Prupe.7G087600_v2.0.a1
pyrus_communis pycom02g22320 pycom03g11340 pycom07g04580 pycom11g14290 pycom11g15110 pycom12g04110 pycom12g04140 pycom12g04160 pycom12g04210 pycom12g04220 pycom12g04230 pycom12g04290 pycom12g04320 pycom12g04330 pycom12g04350 pycom12g04360 pycom14g03880 pycom14g03900 pycom16g18750
rosa_chinensis RchiOBHm_Chr1g0324111 RchiOBHm_Chr1g0324241 RchiOBHm_Chr3g0477691 RchiOBHm_Chr5g0049371 RchiOBHm_Chr5g0070531
rosa_laevigata RLG00000008612 RLG00000023698 RLG00000034613 RLG00000036139
rosa_multiflora Rmu_co8271779.1_g000001 Rmu_sc0006187.1_g000014
rosa_roxburghii Rroxscaffold_1G00010670 Rroxscaffold_1G00030450 Rroxscaffold_1G00031950 Rroxscaffold_1G00031970 Rroxscaffold_1G00032320 Rroxscaffold_1G00055490 Rroxscaffold_2G00083610 Rroxscaffold_2G00084480 Rroxscaffold_2G00115610 Rroxscaffold_3G00261320 Rroxscaffold_4G00312220 Rroxscaffold_4G00325820 Rroxscaffold_5G00339170 Rroxscaffold_5G00364030 Rroxscaffold_6G00403750
rosa_rugosa Rorug03G0162700 Rorug03G0162800 Rorug03G0162900 Rorug05G0247700 Rorug05G0406600 Rorug05G0406800
rosa_samantha Rh1AG060300 Rh3AG213000 Rh3BG246600 Rh3CG240400 Rh3DG239700 Rh5AG324400 Rh5AG462100 Rh5BG335500 Rh5BG480200 Rh5BG480300 Rh5CG360200 Rh5CG504500 Rh5CG504600 Rh5DG347800 Rh5DG492200 Rh5DG492300
rosa_wichuraiana Rw3G019270 Rw3G026910 Rw5G030650 Rw5G032610 Rw5G043040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AflIII ACRYGT 1 cut(s) 118
AgsI TTSAA 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 111
Bpu10I CCTNAGC 1 cut(s) 9
Bse1I ACTGG 1 cut(s) 26
BseNI ACTGG 1 cut(s) 26
BspACI CCGC 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 111
BsrI ACTGG 1 cut(s) 26
Bst4CI ACNGT 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 9, 57
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstNSI RCATGY 1 cut(s) 122
CviAII CATG 2 cut(s) 103, 119
CviJI RGCY 3 cut(s) 49, 56, 152
CviKI_1 RGCY 3 cut(s) 49, 56, 152
DdeI CTNAG 2 cut(s) 9, 57
FaeI CATG 2 cut(s) 106, 122
FaiI YATR 6 cut(s) 23, 72, 76, 104, 120, 164
FalI AAGNNNNNCTT 1 cut(s) 169
FatI CATG 2 cut(s) 102, 118
Hin1II CATG 2 cut(s) 106, 122
HinfI GANTC 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 100
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 169
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpyF3I CTNAG 2 cut(s) 9, 57
Hsp92II CATG 2 cut(s) 106, 122
LpnPI CCDG 1 cut(s) 39
MluCI AATT 1 cut(s) 32
MnlI CCTC 2 cut(s) 126, 130
MspA1I CMGCKG 1 cut(s) 40
MwoI GCNNNNNNNGC 1 cut(s) 46
NlaIII CATG 2 cut(s) 106, 122
NlaIV GGNNCC 1 cut(s) 111
NspI RCATGY 1 cut(s) 122
PciI ACATGT 1 cut(s) 118
PcsI WCGNNNNNNNCGW 1 cut(s) 85
PfeI GAWTC 1 cut(s) 97
PscI ACATGT 1 cut(s) 118
PspN4I GGNNCC 1 cut(s) 111
SetI ASST 1 cut(s) 141
SgeI CNNG 4 cut(s) 38, 115, 131, 189
Sse9I AATT 1 cut(s) 32
SsiI CCGC 1 cut(s) 40
TaaI ACNGT 1 cut(s) 89
TasI AATT 1 cut(s) 32
TfiI GAWTC 1 cut(s) 97
TspDTI ATGAA 2 cut(s) 119, 151
TspGWI ACGGA 1 cut(s) 81
XceI RCATGY 1 cut(s) 122
XcmI CCANNNNNNNNNTGG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.