RchiOBHm_Chr4g0401481

transferase activity, transferring hexosyl groups

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000690
Physical Location & Seq
Forward (+)
19725769 .. 19726022
254 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37338

Sequence Viewer

Length: 153 bp
ATGGCGGAAGTTAGTACACTTGGCAGGATTCATCATGTCAACTTGGTTCGTCTCCATGGTTTCTGCTTTGAGAGACACCTCAGAGCGCTTGTTTATGAGTATATGTCAAATGGTTCGCTTGACAAGTTTCTTTTCCATGGAAACAAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
UDPGT

Protein Analysis

50

Amino Acids

5.86

Weight (kDa)

9.1

Isoelectric Point (pI)

29.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 1 - 45 1.2e-08 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000690)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g07910
malus_domestica MD10G1181800.v1.1 MD10G1181900.v1.1 MD13G1249800.v1.1 MD13G1250100.v1.1 MD13G1250500.v1.1 MD13G1250700.v1.1 MD13G1250900.v1.1 MD13G1251000.v1.1 MD16G1220300.v1.1
prunus_persica Prupe.1G082900_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083100_v2.0.a1 Prupe.1G083300_v2.0.a1
pyrus_communis pycom16g18410 pycom16g18420 pycom16g18430
rosa_chinensis RchiOBHm_Chr4g0401211 RchiOBHm_Chr4g0401231 RchiOBHm_Chr4g0401251 RchiOBHm_Chr4g0401331 RchiOBHm_Chr4g0401351 RchiOBHm_Chr4g0401361 RchiOBHm_Chr4g0401381 RchiOBHm_Chr4g0401471 RchiOBHm_Chr4g0401481 RchiOBHm_Chr4g0401501 RchiOBHm_Chr4g0401511 RchiOBHm_Chr4g0401631 RchiOBHm_Chr4g0401651
rosa_laevigata RLG00000009145 RLG00000009146 RLG00000009148 RLG00000009149 RLG00000009151 RLG00000009154 RLG00000009155
rosa_multiflora Rmu_sc0001524.1_g000025 Rmu_sc0001524.1_g000067 Rmu_sc0003623.1_g000001 Rmu_sc0003623.1_g000027 Rmu_sc0004622.1_g000009 Rmu_sc0004622.1_g000013 Rmu_sc0004622.1_g000018 Rmu_sc0005229.1_g000007 Rmu_sc0005229.1_g000012 Rmu_sc0006444.1_g000002 Rmu_sc0006444.1_g000006 Rmu_sc0012283.1_g000002 Rmu_sc0012283.1_g000003 Rmu_sc0042918.1_g000001
rosa_roxburghii Rroxscaffold_2G00117770 Rroxscaffold_5G00346060 Rroxscaffold_5G00346100 Rroxscaffold_5G00346110 Rroxscaffold_5G00346130 Rroxscaffold_5G00360510
rosa_rugosa Rorug04G0029000 Rorug04G0029200 Rorug04G0029300 Rorug04G0029500 Rorug04G0029600 Rorug04G0030700 Rorug04G0030900
rosa_samantha Rh4AG107600 Rh4BG101300 Rh4CG115900
rosa_wichuraiana Rw4G008620 Rw4G008630 Rw4G008650 Rw4G008660 Rw4G008680 Rw4G008710 Rw4G008730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AfaI GTAC 1 cut(s) 16
AfeI AGCGCT 1 cut(s) 87
Alw26I GTCTC 2 cut(s) 56, 67
Aor51HI AGCGCT 1 cut(s) 87
AspLEI GCGC 1 cut(s) 88
BcoDI GTCTC 2 cut(s) 56, 67
BfoI RGCGCY 1 cut(s) 89
BsaJI CCNNGG 2 cut(s) 55, 136
BseDI CCNNGG 2 cut(s) 55, 136
BseMII CTCAG 1 cut(s) 94
BsmAI GTCTC 2 cut(s) 56, 67
BsmBI CGTCTC 1 cut(s) 56
Bsp19I CCATGG 2 cut(s) 55, 136
BspACI CCGC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 55, 136
BssT1I CCWWGG 2 cut(s) 55, 136
BstDEI CTNAG 1 cut(s) 80
BstDSI CCRYGG 2 cut(s) 55, 136
BstH2I RGCGCY 1 cut(s) 89
BstHHI GCGC 1 cut(s) 88
BstMAI GTCTC 2 cut(s) 56, 67
BtgI CCRYGG 2 cut(s) 55, 136
CfoI GCGC 1 cut(s) 88
Csp6I GTAC 1 cut(s) 15
CviAII CATG 3 cut(s) 35, 56, 137
CviQI GTAC 1 cut(s) 15
DdeI CTNAG 1 cut(s) 80
EciI GGCGGA 1 cut(s) 20
Eco130I CCWWGG 2 cut(s) 55, 136
Eco47III AGCGCT 1 cut(s) 87
EcoT14I CCWWGG 2 cut(s) 55, 136
ErhI CCWWGG 2 cut(s) 55, 136
Esp3I CGTCTC 1 cut(s) 56
FaeI CATG 3 cut(s) 38, 59, 140
FaiI YATR 6 cut(s) 36, 57, 96, 102, 104, 138
FatI CATG 3 cut(s) 34, 55, 136
FspEI CC 9 cut(s) 6, 10, 29, 42, 68, 92, 96, 123, 149
GlaI GCGC 1 cut(s) 87
HaeII RGCGCY 1 cut(s) 89
HhaI GCGC 1 cut(s) 88
Hin1II CATG 3 cut(s) 38, 59, 140
Hin6I GCGC 1 cut(s) 86
HinP1I GCGC 1 cut(s) 86
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HinfI GANTC 1 cut(s) 28
Hpy166II GTNNAC 2 cut(s) 17, 40
Hpy188I TCNGA 1 cut(s) 83
Hpy8I GTNNAC 2 cut(s) 17, 40
HpyF3I CTNAG 1 cut(s) 80
Hsp92II CATG 3 cut(s) 38, 59, 140
HspAI GCGC 1 cut(s) 86
LpnPI CCDG 1 cut(s) 10
MnlI CCTC 1 cut(s) 89
NcoI CCATGG 2 cut(s) 55, 136
NlaIII CATG 3 cut(s) 38, 59, 140
PfeI GAWTC 1 cut(s) 28
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
SetI ASST 1 cut(s) 81
SgeI CNNG 9 cut(s) 32, 37, 47, 55, 68, 101, 131, 136, 149
SsiI CCGC 1 cut(s) 5
StyI CCWWGG 2 cut(s) 55, 136
TatI WGTACW 1 cut(s) 14
TfiI GAWTC 1 cut(s) 28
TspDTI ATGAA 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.