Rmu_sc0005229.1_g000007
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005229.1
Physical Location & Seq
Forward (+)
16832 .. 18205
1374 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005229.1_g000007.1.cds

Sequence Viewer

Length: 1263 bp
atgtcgagtggagttgtgactgttgtagcattagtagttgtctgtgtgatgattgctatcatagttgtatacaggagatatattcgggaacgtagcagctctgatgatccagtctctcatgatccaatcttttcgacacccacaatagacaattttctaattgatatagaaagagagaagcccatcaggtttacttctcaacaacttcagattgcaactgataacttcaccaacttgctgggttcaggagggtttggttcagtttataaaggaaaatttagtaatggaacccttgtggcagtgaaggtcctaaatggtacctcggacaagggaattgaagaacaattcatggcggaagttagaacccttggcaggattcatcatatcaacttggttggtctttatggtttctgctttgagagacacctcagagcaattgtttatgagtatatgtcaaatggttcgcttgataagttgcttttccatggaaacaagaattttggattcgaaaagcttcatgaaattgcggttgggacagctaaagggattgcttacttgcacgaagaatgccagcagcgaatagtccactacgatataaaacctgaaaatattcttttggatgagaacttctttcctaaagtagctgattttggtttggccaagctgttcaacagagataagactcatatatcaatgacagggtggaggggaactcctggttatgctgcaccagaagtttggctgcagtgtcctataacccacaagtgtgatgtgtacagctttggaatgctattatttgagatcataggcagaagaaggaacctagacgacaatcttccggagagtcgagactggtttccaaggtggggatggaagaagtttgaagccggagaactaggagagctaatgctagtttgtggcatagaggagaaacatagagaggcagcggagagaatgttaaaggtagctatctgctgtgttcagtataggccggagttgaggcctttaatgagtgctgtggtgaaaatgttggaaggaggaactgagattcctagaccttcaattaacccacttcagcactcgttgtcaggcactcctgtcatggcatcgtatagcactagtgtcttcgacacggattcctcccatacaacaagtggtgttggcactagtgtcacggattcctctcatacaacaagtggtgttggcactagtgtcttcgacacggattcctctcatacaacaatcggtgttgaaggatgttga

Protein Analysis

420

Amino Acids

46.83

Weight (kDa)

6.11

Isoelectric Point (pI)

40.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000690)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g07910
malus_domestica MD10G1181800.v1.1 MD10G1181900.v1.1 MD13G1249800.v1.1 MD13G1250100.v1.1 MD13G1250500.v1.1 MD13G1250700.v1.1 MD13G1250900.v1.1 MD13G1251000.v1.1 MD16G1220300.v1.1
prunus_persica Prupe.1G082900_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083100_v2.0.a1 Prupe.1G083300_v2.0.a1
pyrus_communis pycom16g18410 pycom16g18420 pycom16g18430
rosa_chinensis RchiOBHm_Chr4g0401211 RchiOBHm_Chr4g0401231 RchiOBHm_Chr4g0401251 RchiOBHm_Chr4g0401331 RchiOBHm_Chr4g0401351 RchiOBHm_Chr4g0401361 RchiOBHm_Chr4g0401381 RchiOBHm_Chr4g0401471 RchiOBHm_Chr4g0401481 RchiOBHm_Chr4g0401501 RchiOBHm_Chr4g0401511 RchiOBHm_Chr4g0401631 RchiOBHm_Chr4g0401651
rosa_laevigata RLG00000009145 RLG00000009146 RLG00000009148 RLG00000009149 RLG00000009151 RLG00000009154 RLG00000009155
rosa_multiflora Rmu_sc0001524.1_g000025 Rmu_sc0001524.1_g000067 Rmu_sc0003623.1_g000001 Rmu_sc0003623.1_g000027 Rmu_sc0004622.1_g000009 Rmu_sc0004622.1_g000013 Rmu_sc0004622.1_g000018 Rmu_sc0005229.1_g000007 Rmu_sc0005229.1_g000012 Rmu_sc0006444.1_g000002 Rmu_sc0006444.1_g000006 Rmu_sc0012283.1_g000002 Rmu_sc0012283.1_g000003 Rmu_sc0042918.1_g000001
rosa_roxburghii Rroxscaffold_2G00117770 Rroxscaffold_5G00346060 Rroxscaffold_5G00346100 Rroxscaffold_5G00346110 Rroxscaffold_5G00346130 Rroxscaffold_5G00360510
rosa_rugosa Rorug04G0029000 Rorug04G0029200 Rorug04G0029300 Rorug04G0029500 Rorug04G0029600 Rorug04G0030700 Rorug04G0030900
rosa_samantha Rh4AG107600 Rh4BG101300 Rh4CG115900
rosa_wichuraiana Rw4G008620 Rw4G008630 Rw4G008650 Rw4G008660 Rw4G008680 Rw4G008710 Rw4G008730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 267
Acc65I GGTACC 1 cut(s) 317
AccB1I GGYRCC 1 cut(s) 317
AccI GTMKAC 1 cut(s) 69
AccIII TCCGGA 1 cut(s) 838
AciI CCGC 3 cut(s) 353, 527, 947
AclWI GGATC 2 cut(s) 101, 116
AcoI YGGCCR 1 cut(s) 657
AcsI RAATTY 2 cut(s) 275, 496
AcuI CTGAAG 2 cut(s) 191, 1058
AfaI GTAC 2 cut(s) 319, 776
AfiI CCNNNNNNNGG 2 cut(s) 372, 866
AgsI TTSAA 5 cut(s) 338, 670, 884, 1062, 1253
AhlI ACTAGT 3 cut(s) 1118, 1166, 1208
AjnI CCWGG 1 cut(s) 715
AjuI GAANNNNNNNTTGG 2 cut(s) 513, 545
AleI CACNNNNGTG 1 cut(s) 765
AloI GAACNNNNNNTCC 2 cut(s) 1033, 1065
AluBI AGCT 8 cut(s) 99, 514, 539, 644, 664, 780, 904, 968
AluI AGCT 8 cut(s) 99, 514, 539, 644, 664, 780, 904, 968
Alw26I GTCTC 3 cut(s) 118, 415, 843
AlwI GGATC 2 cut(s) 101, 116
Aor13HI TCCGGA 1 cut(s) 838
AoxI GGCC 3 cut(s) 657, 989, 1001
ApeKI GCWGC 5 cut(s) 96, 574, 725, 742, 944
ApoI RAATTY 2 cut(s) 275, 496
Asp700I GAANNNNTTC 2 cut(s) 513, 609
Asp718I GGTACC 1 cut(s) 317
AspS9I GGNCC 1 cut(s) 307
AsuHPI GGTGA 2 cut(s) 220, 1033
AsuII TTCGAA 1 cut(s) 507
AvaII GGWCC 1 cut(s) 307
BalI TGGCCA 1 cut(s) 659
BanI GGYRCC 1 cut(s) 317
BbsI GAAGAC 2 cut(s) 1117, 1207
BbvI GCAGC 5 cut(s) 108, 586, 712, 729, 956
BccI CCATC 2 cut(s) 191, 864
BciT130I CCWGG 1 cut(s) 717
BcoDI GTCTC 3 cut(s) 118, 415, 843
BcuI ACTAGT 3 cut(s) 1118, 1166, 1208
BfaI CTAG 7 cut(s) 824, 896, 911, 1053, 1119, 1167, 1209
BfmI CTRYAG 1 cut(s) 743
BisI GCNGC 5 cut(s) 97, 575, 726, 743, 945
BlsI GCNGC 5 cut(s) 98, 576, 727, 744, 946
Bme1390I CCNGG 1 cut(s) 717
Bme18I GGWCC 1 cut(s) 307
BmgT120I GGNCC 1 cut(s) 307
BmiI GGNNCC 3 cut(s) 289, 319, 821
BmrFI CCNGG 1 cut(s) 717
BmsI GCATC 1 cut(s) 1115
BpiI GAAGAC 2 cut(s) 1117, 1207
BplI GAGNNNNNCTC 2 cut(s) 697, 729
Bpu14I TTCGAA 1 cut(s) 507
BsaBI GATNNNNATC 1 cut(s) 56
BsaJI CCNNGG 4 cut(s) 321, 367, 484, 860
BsaWI WCCGGW 1 cut(s) 838
BsaXI ACNNNNNCTCC 2 cut(s) 941, 971
Bsc4I CCNNNNNNNGG 2 cut(s) 372, 866
Bse1I ACTGG 2 cut(s) 110, 857
Bse8I GATNNNNATC 1 cut(s) 56
BseAI TCCGGA 1 cut(s) 838
BseBI CCWGG 1 cut(s) 717
BseDI CCNNGG 4 cut(s) 321, 367, 484, 860
BseGI GGATG 3 cut(s) 625, 875, 1262
BseJI GATNNNNATC 1 cut(s) 56
BseLI CCNNNNNNNGG 2 cut(s) 372, 866
BseMII CTCAG 2 cut(s) 442, 1035
BseNI ACTGG 2 cut(s) 110, 857
BseRI GAGGAG 1 cut(s) 941
BseXI GCAGC 5 cut(s) 108, 586, 712, 729, 956
BseYI CCCAGC 1 cut(s) 238
BsgI GTGCAG 1 cut(s) 711
BshFI GGCC 3 cut(s) 659, 991, 1003
BshNI GGYRCC 1 cut(s) 317
BsiSI CCGG 3 cut(s) 839, 888, 992
BslFI GGGAC 1 cut(s) 547
BslI CCNNNNNNNGG 2 cut(s) 372, 866
BsmAI GTCTC 3 cut(s) 118, 415, 843
BsmFI GGGAC 1 cut(s) 547
BsmI GAATGC 2 cut(s) 572, 792
BsnI GGCC 3 cut(s) 659, 991, 1003
Bsp119I TTCGAA 1 cut(s) 507
Bsp13I TCCGGA 1 cut(s) 838
Bsp1407I TGTACA 1 cut(s) 774
Bsp143I GATC 3 cut(s) 106, 121, 801
Bsp19I CCATGG 1 cut(s) 484
BspACI CCGC 3 cut(s) 353, 527, 947
BspANI GGCC 3 cut(s) 659, 991, 1003
BspCNI CTCAG 2 cut(s) 441, 1036
BspEI TCCGGA 1 cut(s) 838
BspHI TCATGA 2 cut(s) 118, 517
BspLI GGNNCC 3 cut(s) 289, 319, 821
BspMAI CTGCAG 1 cut(s) 747
BspPI GGATC 2 cut(s) 101, 116
BspT104I TTCGAA 1 cut(s) 507
BspT107I GGYRCC 1 cut(s) 317
BsrGI TGTACA 1 cut(s) 774
BsrI ACTGG 2 cut(s) 110, 857
BssECI CCNNGG 4 cut(s) 321, 367, 484, 860
BssMI GATC 3 cut(s) 106, 121, 801
BssNAI GTATAC 1 cut(s) 70
BssT1I CCWWGG 3 cut(s) 367, 484, 860
Bst1107I GTATAC 1 cut(s) 70
Bst2UI CCWGG 1 cut(s) 717
Bst4CI ACNGT 1 cut(s) 22
BstAUI TGTACA 1 cut(s) 774
BstBI TTCGAA 1 cut(s) 507
BstC8I GCNNGC 1 cut(s) 572
BstDEI CTNAG 2 cut(s) 428, 1044
BstDSI CCRYGG 1 cut(s) 484
BstF5I GGATG 3 cut(s) 625, 875, 1262
BstKTI GATC 3 cut(s) 109, 124, 804
BstMAI GTCTC 3 cut(s) 118, 415, 843
BstMBI GATC 3 cut(s) 106, 121, 801
BstNI CCWGG 1 cut(s) 717
BstSCI CCNGG 1 cut(s) 715
BstSFI CTRYAG 1 cut(s) 743
BstV1I GCAGC 5 cut(s) 108, 586, 712, 729, 956
BstV2I GAAGAC 2 cut(s) 1117, 1207
BstXI CCANNNNNNTGG 2 cut(s) 238, 738
BstZ17I GTATAC 1 cut(s) 70
BsuRI GGCC 3 cut(s) 659, 991, 1003
BtgI CCRYGG 1 cut(s) 484
BtsCI GGATG 3 cut(s) 625, 875, 1262
BtsI GCAGTG 2 cut(s) 306, 752
BtsIMutI CAGTG 2 cut(s) 306, 752
Cac8I GCNNGC 1 cut(s) 572
CciI TCATGA 2 cut(s) 118, 517
Cfr13I GGNCC 1 cut(s) 307
Csp6I GTAC 2 cut(s) 318, 775
CviAII CATG 5 cut(s) 119, 349, 485, 518, 1102
CviQI GTAC 2 cut(s) 318, 775
DdeI CTNAG 2 cut(s) 428, 1044
DpnI GATC 3 cut(s) 108, 123, 803
DpnII GATC 3 cut(s) 106, 121, 801
EaeI YGGCCR 1 cut(s) 657
EciI GGCGGA 1 cut(s) 368
Eco130I CCWWGG 3 cut(s) 367, 484, 860
Eco147I AGGCCT 1 cut(s) 1003
Eco47I GGWCC 1 cut(s) 307
Eco57I CTGAAG 2 cut(s) 191, 1058
EcoO109I RGGNCCY 1 cut(s) 307
EcoRII CCWGG 1 cut(s) 715
EcoT14I CCWWGG 3 cut(s) 367, 484, 860
ErhI CCWWGG 3 cut(s) 367, 484, 860
FaeI CATG 5 cut(s) 122, 352, 488, 521, 1105
FaqI GGGAC 1 cut(s) 547
FatI CATG 5 cut(s) 118, 348, 484, 517, 1101
FblI GTMKAC 1 cut(s) 69
Fnu4HI GCNGC 5 cut(s) 97, 575, 726, 743, 945
FokI GGATG 2 cut(s) 632, 882
Fsp4HI GCNGC 5 cut(s) 97, 575, 726, 743, 945
FspBI CTAG 7 cut(s) 824, 896, 911, 1053, 1119, 1167, 1209
GluI GCNGC 5 cut(s) 97, 575, 726, 743, 945
GsaI CCCAGC 1 cut(s) 242
HaeIII GGCC 3 cut(s) 659, 991, 1003
HapII CCGG 3 cut(s) 839, 888, 992
Hin1II CATG 5 cut(s) 122, 352, 488, 521, 1105
HindIII AAGCTT 1 cut(s) 512
HinfI GANTC 8 cut(s) 376, 504, 682, 844, 1048, 1136, 1178, 1226
HpaII CCGG 3 cut(s) 839, 888, 992
HphI GGTGA 2 cut(s) 220, 1033
Hpy166II GTNNAC 4 cut(s) 70, 192, 586, 775
Hpy188I TCNGA 4 cut(s) 103, 210, 325, 431
Hpy188III TCNNGA 6 cut(s) 86, 119, 246, 518, 839, 848
Hpy8I GTNNAC 4 cut(s) 70, 192, 586, 775
HpyAV CCTTC 5 cut(s) 298, 810, 1028, 1068, 1247
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4IV ACGT 1 cut(s) 91
HpyCH4V TGCA 4 cut(s) 215, 559, 728, 745
HpyF3I CTNAG 2 cut(s) 428, 1044
HpySE526I ACGT 1 cut(s) 91
Hsp92II CATG 5 cut(s) 122, 352, 488, 521, 1105
Kpn2I TCCGGA 1 cut(s) 838
KpnI GGTACC 1 cut(s) 321
Kzo9I GATC 3 cut(s) 106, 121, 801
Lsp1109I GCAGC 5 cut(s) 108, 586, 712, 729, 956
LweI GCATC 1 cut(s) 1115
MaeI CTAG 7 cut(s) 824, 896, 911, 1053, 1119, 1167, 1209
MaeII ACGT 1 cut(s) 91
MaeIII GTNAC 2 cut(s) 16, 1171
MalI GATC 3 cut(s) 108, 123, 803
MboI GATC 3 cut(s) 106, 121, 801
MboII GAAGA 7 cut(s) 350, 575, 825, 827, 886, 1117, 1207
MfeI CAATTG 1 cut(s) 435
MlsI TGGCCA 1 cut(s) 659
MluCI AATT 9 cut(s) 151, 159, 275, 333, 344, 435, 496, 522, 1062
MluNI TGGCCA 1 cut(s) 659
MlyI GAGTC 2 cut(s) 676, 853
MmeI TCCRAC 1 cut(s) 1011
Mox20I TGGCCA 1 cut(s) 659
MroI TCCGGA 1 cut(s) 838
MroXI GAANNNNTTC 2 cut(s) 513, 609
MscI TGGCCA 1 cut(s) 659
MseI TTAA 3 cut(s) 959, 1007, 1065
MslI CAYNNNNRTG 1 cut(s) 765
Msp20I TGGCCA 1 cut(s) 659
MspA1I CMGCKG 1 cut(s) 947
MspI CCGG 3 cut(s) 839, 888, 992
MspR9I CCNGG 1 cut(s) 717
MunI CAATTG 1 cut(s) 435
Mva1269I GAATGC 2 cut(s) 572, 792
MvaI CCWGG 1 cut(s) 717
NcoI CCATGG 1 cut(s) 484
NdeII GATC 3 cut(s) 106, 121, 801
NlaIII CATG 5 cut(s) 122, 352, 488, 521, 1105
NlaIV GGNNCC 3 cut(s) 289, 319, 821
NmuCI GTSAC 2 cut(s) 16, 1171
NspV TTCGAA 1 cut(s) 507
OliI CACNNNNGTG 1 cut(s) 765
PagI TCATGA 2 cut(s) 118, 517
PceI AGGCCT 1 cut(s) 1003
PctI GAATGC 2 cut(s) 572, 792
PdmI GAANNNNTTC 2 cut(s) 513, 609
PfeI GAWTC 6 cut(s) 376, 504, 1048, 1136, 1178, 1226
PkrI GCNGC 5 cut(s) 98, 576, 727, 744, 946
PleI GAGTC 2 cut(s) 676, 852
PpsI GAGTC 2 cut(s) 676, 852
PpuMI RGGWCCY 1 cut(s) 307
PsiI TTATAA 1 cut(s) 267
Psp5II RGGWCCY 1 cut(s) 307
Psp6I CCWGG 1 cut(s) 715
PspFI CCCAGC 1 cut(s) 238
PspGI CCWGG 1 cut(s) 715
PspN4I GGNNCC 3 cut(s) 289, 319, 821
PspPI GGNCC 1 cut(s) 307
PspPPI RGGWCCY 1 cut(s) 307
PstI CTGCAG 1 cut(s) 747
RsaI GTAC 2 cut(s) 319, 776
RsaNI GTAC 2 cut(s) 318, 775
RseI CAYNNNNRTG 1 cut(s) 765
SaqAI TTAA 3 cut(s) 959, 1007, 1065
SatI GCNGC 5 cut(s) 97, 575, 726, 743, 945
Sau3AI GATC 3 cut(s) 106, 121, 801
Sau96I GGNCC 1 cut(s) 307
SchI GAGTC 2 cut(s) 676, 853
ScrFI CCNGG 1 cut(s) 717
SfaNI GCATC 1 cut(s) 1115
SfcI CTRYAG 1 cut(s) 743
SfuI TTCGAA 1 cut(s) 507
SinI GGWCC 1 cut(s) 307
SmiMI CAYNNNNRTG 1 cut(s) 765
SpeI ACTAGT 3 cut(s) 1118, 1166, 1208
Sse9I AATT 9 cut(s) 151, 159, 275, 333, 344, 435, 496, 522, 1062
SseBI AGGCCT 1 cut(s) 1003
SsiI CCGC 3 cut(s) 353, 527, 947
SspI AATATT 1 cut(s) 610
SspMI CTAG 7 cut(s) 824, 896, 911, 1053, 1119, 1167, 1209
StuI AGGCCT 1 cut(s) 1003
StyD4I CCNGG 1 cut(s) 715
StyI CCWWGG 3 cut(s) 367, 484, 860
TaaI ACNGT 1 cut(s) 22
TaiI ACGT 1 cut(s) 94
TaqI TCGA 6 cut(s) 5, 134, 507, 847, 1128, 1218
TasI AATT 9 cut(s) 151, 159, 275, 333, 344, 435, 496, 522, 1062
TatI WGTACW 1 cut(s) 774
TfiI GAWTC 6 cut(s) 376, 504, 1048, 1136, 1178, 1226
Tru1I TTAA 3 cut(s) 959, 1007, 1065
Tru9I TTAA 3 cut(s) 959, 1007, 1065
TscAI CASTG 2 cut(s) 306, 752
TseFI GTSAC 2 cut(s) 16, 1171
TseI GCWGC 5 cut(s) 96, 574, 725, 742, 944
Tsp45I GTSAC 2 cut(s) 16, 1171
TspDTI ATGAA 4 cut(s) 337, 368, 506, 534
TspGWI ACGGA 3 cut(s) 1148, 1190, 1238
TspRI CASTG 2 cut(s) 306, 752
VpaK11BI GGWCC 1 cut(s) 307
XapI RAATTY 2 cut(s) 275, 496
XcmI CCANNNNNNNNNTGG 2 cut(s) 867, 1151
XmiI GTMKAC 1 cut(s) 69
XmnI GAANNNNTTC 2 cut(s) 513, 609
XspI CTAG 7 cut(s) 824, 896, 911, 1053, 1119, 1167, 1209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.