Rorug04G0029200
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
4118205 .. 4120955
2751 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0029200.1

Sequence Viewer

Length: 462 bp
ATGTGGAGGGAAATCAAACTTTTGGCTGCATCAAAACCGGACATCGCATCAATGTCTGACGTGGCAGCAAGTGGAGGATACTATATGGCAATGGCAGCAGATGCCATTGTTGCAGAAAATTTAACCTTAACTGGTTCCATTAGACTAGAGGAAGCTGAACTCTTTGCTAAGTCTGCACAGAATTCGTATAAGCAATTTCAGGACAAGGCAGCTTCTTCCAAATCAATGACTATAGATAAAATGGAGGAAGTTGCACAAGGGAGAGTTTGGGCAGGTAAAGATGCAGCTTCAAGGGATTTAGTTAATGCTATTGGTGGACTTTCTCAGGTTGTTGCAATAGCAAAGCTCAAGGCAAATATACCACAAGACACAGAGGTTACACTAGTGGAACTTGCAAGACCATCCCCTTCACTGCCAAAACTTTTAAGTGTAGGGAGTACTCTGGAGGGAGTTGCTTTCTAG

Protein Analysis

153

Amino Acids

16.21

Weight (kDa)

5.21

Isoelectric Point (pI)

36.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_S49 PF01343 8 - 47 1.1e-10 Peptidase family S49
Peptidase_S49 PF01343 50 - 119 4e-10 Peptidase family S49
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000690)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g07910
malus_domestica MD10G1181800.v1.1 MD10G1181900.v1.1 MD13G1249800.v1.1 MD13G1250100.v1.1 MD13G1250500.v1.1 MD13G1250700.v1.1 MD13G1250900.v1.1 MD13G1251000.v1.1 MD16G1220300.v1.1
prunus_persica Prupe.1G082900_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083100_v2.0.a1 Prupe.1G083300_v2.0.a1
pyrus_communis pycom16g18410 pycom16g18420 pycom16g18430
rosa_chinensis RchiOBHm_Chr4g0401211 RchiOBHm_Chr4g0401231 RchiOBHm_Chr4g0401251 RchiOBHm_Chr4g0401331 RchiOBHm_Chr4g0401351 RchiOBHm_Chr4g0401361 RchiOBHm_Chr4g0401381 RchiOBHm_Chr4g0401471 RchiOBHm_Chr4g0401481 RchiOBHm_Chr4g0401501 RchiOBHm_Chr4g0401511 RchiOBHm_Chr4g0401631 RchiOBHm_Chr4g0401651
rosa_laevigata RLG00000009145 RLG00000009146 RLG00000009148 RLG00000009149 RLG00000009151 RLG00000009154 RLG00000009155
rosa_multiflora Rmu_sc0001524.1_g000025 Rmu_sc0001524.1_g000067 Rmu_sc0003623.1_g000001 Rmu_sc0003623.1_g000027 Rmu_sc0004622.1_g000009 Rmu_sc0004622.1_g000013 Rmu_sc0004622.1_g000018 Rmu_sc0005229.1_g000007 Rmu_sc0005229.1_g000012 Rmu_sc0006444.1_g000002 Rmu_sc0006444.1_g000006 Rmu_sc0012283.1_g000002 Rmu_sc0012283.1_g000003 Rmu_sc0042918.1_g000001
rosa_roxburghii Rroxscaffold_2G00117770 Rroxscaffold_5G00346060 Rroxscaffold_5G00346100 Rroxscaffold_5G00346110 Rroxscaffold_5G00346130 Rroxscaffold_5G00360510
rosa_rugosa Rorug04G0029000 Rorug04G0029200 Rorug04G0029300 Rorug04G0029500 Rorug04G0029600 Rorug04G0030700 Rorug04G0030900
rosa_samantha Rh4AG107600 Rh4BG101300 Rh4CG115900
rosa_wichuraiana Rw4G008620 Rw4G008630 Rw4G008650 Rw4G008660 Rw4G008680 Rw4G008710 Rw4G008730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 263
AcsI RAATTY 2 cut(s) 118, 181
AfaI GTAC 1 cut(s) 439
AgsI TTSAA 1 cut(s) 291
AhlI ACTAGT 1 cut(s) 382
AjiI CACGTC 1 cut(s) 61
AluBI AGCT 4 cut(s) 155, 212, 287, 346
AluI AGCT 4 cut(s) 155, 212, 287, 346
ApeKI GCWGC 5 cut(s) 26, 65, 95, 209, 284
ApoI RAATTY 2 cut(s) 118, 181
BbvI GCAGC 5 cut(s) 13, 77, 107, 221, 296
BccI CCATC 1 cut(s) 409
BcgI CGANNNNNNTGC 2 cut(s) 165, 199
BciVI GTATCC 1 cut(s) 71
BcuI ACTAGT 1 cut(s) 382
BfaI CTAG 3 cut(s) 146, 383, 460
BfmI CTRYAG 1 cut(s) 231
BfuAI ACCTGC 1 cut(s) 263
BfuI GTATCC 1 cut(s) 71
BisI GCNGC 5 cut(s) 27, 66, 96, 210, 285
BlsI GCNGC 5 cut(s) 28, 67, 97, 211, 286
BmcAI AGTACT 1 cut(s) 439
BmgBI CACGTC 1 cut(s) 61
BmiI GGNNCC 1 cut(s) 136
BmsI GCATC 4 cut(s) 38, 56, 91, 271
BpuEI CTTGAG 1 cut(s) 332
BsaWI WCCGGW 1 cut(s) 37
Bse1I ACTGG 1 cut(s) 136
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 401
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 338
BseNI ACTGG 1 cut(s) 136
BseXI GCAGC 5 cut(s) 13, 77, 107, 221, 296
BsgI GTGCAG 1 cut(s) 159
BsiSI CCGG 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 337
BspLI GGNNCC 1 cut(s) 136
BspMI ACCTGC 1 cut(s) 263
BsrDI GCAATG 1 cut(s) 96
BsrI ACTGG 1 cut(s) 136
BstAPI GCANNNNNTGC 1 cut(s) 101
BstDEI CTNAG 2 cut(s) 168, 324
BstF5I GGATG 1 cut(s) 401
BstMWI GCNNNNNNNGC 4 cut(s) 95, 101, 110, 173
BstSFI CTRYAG 1 cut(s) 231
BstV1I GCAGC 5 cut(s) 13, 77, 107, 221, 296
BsuI GTATCC 1 cut(s) 71
BtgZI GCGATG 1 cut(s) 28
BtrI CACGTC 1 cut(s) 61
BtsCI GGATG 1 cut(s) 401
BtsI GCAGTG 1 cut(s) 410
BtsIMutI CAGTG 1 cut(s) 410
BveI ACCTGC 1 cut(s) 263
Csp6I GTAC 1 cut(s) 438
CviJI RGCY 5 cut(s) 26, 155, 212, 287, 346
CviKI_1 RGCY 5 cut(s) 26, 155, 212, 287, 346
CviQI GTAC 1 cut(s) 438
DdeI CTNAG 2 cut(s) 168, 324
EcoRI GAATTC 1 cut(s) 181
FaiI YATR 5 cut(s) 84, 86, 189, 233, 359
Fnu4HI GCNGC 5 cut(s) 27, 66, 96, 210, 285
FokI GGATG 1 cut(s) 388
Fsp4HI GCNGC 5 cut(s) 27, 66, 96, 210, 285
FspBI CTAG 3 cut(s) 146, 383, 460
GluI GCNGC 5 cut(s) 27, 66, 96, 210, 285
HapII CCGG 1 cut(s) 38
HpaII CCGG 1 cut(s) 38
Hpy166II GTNNAC 1 cut(s) 317
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 200, 443
Hpy8I GTNNAC 1 cut(s) 317
HpyAV CCTTC 1 cut(s) 417
HpyCH4IV ACGT 1 cut(s) 60
HpyCH4V TGCA 7 cut(s) 29, 113, 176, 254, 284, 335, 395
HpyF10VI GCNNNNNNNGC 4 cut(s) 95, 101, 110, 173
HpyF3I CTNAG 2 cut(s) 168, 324
HpySE526I ACGT 1 cut(s) 60
LpnPI CCDG 6 cut(s) 51, 117, 185, 258, 311, 428
Lsp1109I GCAGC 5 cut(s) 13, 77, 107, 221, 296
LweI GCATC 4 cut(s) 38, 56, 91, 271
MaeI CTAG 3 cut(s) 146, 383, 460
MaeII ACGT 1 cut(s) 60
MaeIII GTNAC 1 cut(s) 376
MboII GAAGA 1 cut(s) 207
MluCI AATT 3 cut(s) 118, 181, 194
MnlI CCTC 5 cut(s) 68, 142, 238, 367, 439
MseI TTAA 4 cut(s) 122, 128, 303, 425
MspI CCGG 1 cut(s) 38
MwoI GCNNNNNNNGC 4 cut(s) 95, 101, 110, 173
NlaIV GGNNCC 1 cut(s) 136
PkrI GCNGC 5 cut(s) 28, 67, 97, 211, 286
PspN4I GGNNCC 1 cut(s) 136
RsaI GTAC 1 cut(s) 439
RsaNI GTAC 1 cut(s) 438
SaqAI TTAA 4 cut(s) 122, 128, 303, 425
SatI GCNGC 5 cut(s) 27, 66, 96, 210, 285
ScaI AGTACT 1 cut(s) 439
SetI ASST 9 cut(s) 63, 128, 157, 214, 277, 289, 330, 348, 378
SfaNI GCATC 4 cut(s) 38, 56, 91, 271
SfcI CTRYAG 1 cut(s) 231
SmlI CTYRAG 1 cut(s) 347
SmoI CTYRAG 1 cut(s) 347
SpeI ACTAGT 1 cut(s) 382
Sse9I AATT 3 cut(s) 118, 181, 194
SspMI CTAG 3 cut(s) 146, 383, 460
TaiI ACGT 1 cut(s) 63
TasI AATT 3 cut(s) 118, 181, 194
TatI WGTACW 1 cut(s) 437
Tru1I TTAA 4 cut(s) 122, 128, 303, 425
Tru9I TTAA 4 cut(s) 122, 128, 303, 425
TscAI CASTG 1 cut(s) 417
TseI GCWGC 5 cut(s) 26, 65, 95, 209, 284
TspRI CASTG 1 cut(s) 417
XapI RAATTY 2 cut(s) 118, 181
XspI CTAG 3 cut(s) 146, 383, 460
ZrmI AGTACT 1 cut(s) 439
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.