Rmu_sc0001524.1_g000067
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001524.1
Physical Location & Seq
Reverse (-)
248175 .. 249180
1006 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001524.1_g000067.1.cds

Sequence Viewer

Length: 879 bp
atgattgctatcatagttgtatacaggagatatattcgggaacgtagcagctctgatgatccagtctctcatgatccaatcttttcgacacccacaatagacaattttctaattgatatagaaagagagaagcccatcaggtttacttctcaacaacttcagattgcaactgataacttcaccaacttgctgggttcaggagggtttggttcagtttataaaggaaaatttagtaatggaacccttgtggcagtgaaggtcctaaatggtacctcggacaagggaattgaagaacaattcatggcggaagttagaacccttggcaggattcatcatatcaacttggttggtctttatggtttctgctttgagagacacgtcagagcaattgtttatgagtatatgtcaaatggttcgcttgagaagtttcttttccatgggaacaagattttaggattcgaaaagcttcatgaaattgcagttgggacagctagagggattgcttacttgcacgaagaatgccagcagcgaatagtccactacaatataaaacctgaaaatattcttttggatgagaacttctttcctaaagtagctgattttgctttggaatgctattatttgagaattgagatcataggcagaagaaggaacctagacctcaatcttccggagggtcaagactggtttccaaggtggggatggaagaagtttgaagctggagaactaggagagctaatgctagtttgtggcatagaggagaaagacagagaggcagcagagagaatgttaaaggttgctatcggctgtgttcagtataggcccgagttgaggcctttaatgagtgctttggtgaaaatgttggaaggagaaatttag

Protein Analysis

292

Amino Acids

33.57

Weight (kDa)

6.11

Isoelectric Point (pI)

45.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000690)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g07910
malus_domestica MD10G1181800.v1.1 MD10G1181900.v1.1 MD13G1249800.v1.1 MD13G1250100.v1.1 MD13G1250500.v1.1 MD13G1250700.v1.1 MD13G1250900.v1.1 MD13G1251000.v1.1 MD16G1220300.v1.1
prunus_persica Prupe.1G082900_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083000_v2.0.a1 Prupe.1G083100_v2.0.a1 Prupe.1G083300_v2.0.a1
pyrus_communis pycom16g18410 pycom16g18420 pycom16g18430
rosa_chinensis RchiOBHm_Chr4g0401211 RchiOBHm_Chr4g0401231 RchiOBHm_Chr4g0401251 RchiOBHm_Chr4g0401331 RchiOBHm_Chr4g0401351 RchiOBHm_Chr4g0401361 RchiOBHm_Chr4g0401381 RchiOBHm_Chr4g0401471 RchiOBHm_Chr4g0401481 RchiOBHm_Chr4g0401501 RchiOBHm_Chr4g0401511 RchiOBHm_Chr4g0401631 RchiOBHm_Chr4g0401651
rosa_laevigata RLG00000009145 RLG00000009146 RLG00000009148 RLG00000009149 RLG00000009151 RLG00000009154 RLG00000009155
rosa_multiflora Rmu_sc0001524.1_g000025 Rmu_sc0001524.1_g000067 Rmu_sc0003623.1_g000001 Rmu_sc0003623.1_g000027 Rmu_sc0004622.1_g000009 Rmu_sc0004622.1_g000013 Rmu_sc0004622.1_g000018 Rmu_sc0005229.1_g000007 Rmu_sc0005229.1_g000012 Rmu_sc0006444.1_g000002 Rmu_sc0006444.1_g000006 Rmu_sc0012283.1_g000002 Rmu_sc0012283.1_g000003 Rmu_sc0042918.1_g000001
rosa_roxburghii Rroxscaffold_2G00117770 Rroxscaffold_5G00346060 Rroxscaffold_5G00346100 Rroxscaffold_5G00346110 Rroxscaffold_5G00346130 Rroxscaffold_5G00360510
rosa_rugosa Rorug04G0029000 Rorug04G0029200 Rorug04G0029300 Rorug04G0029500 Rorug04G0029600 Rorug04G0030700 Rorug04G0030900
rosa_samantha Rh4AG107600 Rh4BG101300 Rh4CG115900
rosa_wichuraiana Rw4G008620 Rw4G008630 Rw4G008650 Rw4G008660 Rw4G008680 Rw4G008710 Rw4G008730

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 219
Acc65I GGTACC 1 cut(s) 269
AccB1I GGYRCC 1 cut(s) 269
AccI GTMKAC 1 cut(s) 21
AccIII TCCGGA 1 cut(s) 670
AciI CCGC 1 cut(s) 305
AclWI GGATC 2 cut(s) 53, 68
AcsI RAATTY 2 cut(s) 227, 873
AcuI CTGAAG 1 cut(s) 143
AfaI GTAC 1 cut(s) 271
AfiI CCNNNNNNNGG 3 cut(s) 324, 698, 831
AflIII ACRYGT 1 cut(s) 376
AgsI TTSAA 2 cut(s) 290, 716
AjiI CACGTC 1 cut(s) 379
AjuI GAANNNNNNNTTGG 2 cut(s) 465, 497
AluBI AGCT 6 cut(s) 51, 466, 491, 596, 719, 736
AluI AGCT 6 cut(s) 51, 466, 491, 596, 719, 736
Alw26I GTCTC 2 cut(s) 70, 367
AlwI GGATC 2 cut(s) 53, 68
Ama87I CYCGRG 1 cut(s) 824
Aor13HI TCCGGA 1 cut(s) 670
AoxI GGCC 2 cut(s) 821, 833
ApeKI GCWGC 3 cut(s) 48, 526, 776
ApoI RAATTY 2 cut(s) 227, 873
Asp700I GAANNNNTTC 2 cut(s) 465, 561
Asp718I GGTACC 1 cut(s) 269
AspS9I GGNCC 2 cut(s) 259, 822
AsuHPI GGTGA 2 cut(s) 172, 865
AsuII TTCGAA 1 cut(s) 459
AvaI CYCGRG 1 cut(s) 824
AvaII GGWCC 1 cut(s) 259
BanI GGYRCC 1 cut(s) 269
BbvI GCAGC 3 cut(s) 60, 538, 788
BccI CCATC 2 cut(s) 143, 696
BcoDI GTCTC 2 cut(s) 70, 367
BfaI CTAG 4 cut(s) 492, 656, 728, 743
BisI GCNGC 3 cut(s) 49, 527, 777
BlsI GCNGC 3 cut(s) 50, 528, 778
Bme18I GGWCC 1 cut(s) 259
BmeT110I CYCGRG 1 cut(s) 824
BmgBI CACGTC 1 cut(s) 379
BmgT120I GGNCC 2 cut(s) 259, 822
BmiI GGNNCC 3 cut(s) 241, 271, 653
BpmI CTGGAG 1 cut(s) 741
Bpu14I TTCGAA 1 cut(s) 459
BpuEI CTTGAG 1 cut(s) 440
BsaBI GATNNNNATC 1 cut(s) 8
BsaJI CCNNGG 4 cut(s) 273, 319, 436, 692
BsaWI WCCGGW 1 cut(s) 670
Bsc4I CCNNNNNNNGG 3 cut(s) 324, 698, 831
Bse1I ACTGG 2 cut(s) 62, 689
Bse8I GATNNNNATC 1 cut(s) 8
BseAI TCCGGA 1 cut(s) 670
BseDI CCNNGG 4 cut(s) 273, 319, 436, 692
BseGI GGATG 2 cut(s) 577, 707
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 3 cut(s) 324, 698, 831
BseNI ACTGG 2 cut(s) 62, 689
BseRI GAGGAG 1 cut(s) 773
BseXI GCAGC 3 cut(s) 60, 538, 788
BseYI CCCAGC 1 cut(s) 190
BshFI GGCC 2 cut(s) 823, 835
BshNI GGYRCC 1 cut(s) 269
BsiHKCI CYCGRG 1 cut(s) 824
BsiSI CCGG 1 cut(s) 671
BslFI GGGAC 1 cut(s) 499
BslI CCNNNNNNNGG 3 cut(s) 324, 698, 831
BsmAI GTCTC 2 cut(s) 70, 367
BsmFI GGGAC 1 cut(s) 499
BsmI GAATGC 2 cut(s) 524, 617
BsnI GGCC 2 cut(s) 823, 835
BsoBI CYCGRG 1 cut(s) 824
Bsp119I TTCGAA 1 cut(s) 459
Bsp13I TCCGGA 1 cut(s) 670
Bsp143I GATC 3 cut(s) 58, 73, 633
Bsp19I CCATGG 1 cut(s) 436
BspACI CCGC 1 cut(s) 305
BspANI GGCC 2 cut(s) 823, 835
BspEI TCCGGA 1 cut(s) 670
BspHI TCATGA 2 cut(s) 70, 469
BspLI GGNNCC 3 cut(s) 241, 271, 653
BspPI GGATC 2 cut(s) 53, 68
BspT104I TTCGAA 1 cut(s) 459
BspT107I GGYRCC 1 cut(s) 269
BsrI ACTGG 2 cut(s) 62, 689
BssECI CCNNGG 4 cut(s) 273, 319, 436, 692
BssMI GATC 3 cut(s) 58, 73, 633
BssNAI GTATAC 1 cut(s) 22
BssT1I CCWWGG 3 cut(s) 319, 436, 692
Bst1107I GTATAC 1 cut(s) 22
BstBI TTCGAA 1 cut(s) 459
BstC8I GCNNGC 1 cut(s) 524
BstDSI CCRYGG 1 cut(s) 436
BstF5I GGATG 2 cut(s) 577, 707
BstKTI GATC 3 cut(s) 61, 76, 636
BstMAI GTCTC 2 cut(s) 70, 367
BstMBI GATC 3 cut(s) 58, 73, 633
BstMWI GCNNNNNNNGC 1 cut(s) 602
BstV1I GCAGC 3 cut(s) 60, 538, 788
BstXI CCANNNNNNTGG 1 cut(s) 190
BstZ17I GTATAC 1 cut(s) 22
BsuRI GGCC 2 cut(s) 823, 835
BtgI CCRYGG 1 cut(s) 436
BtrI CACGTC 1 cut(s) 379
BtsCI GGATG 2 cut(s) 577, 707
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 258
Cac8I GCNNGC 1 cut(s) 524
CciI TCATGA 2 cut(s) 70, 469
Cfr13I GGNCC 2 cut(s) 259, 822
Csp6I GTAC 1 cut(s) 270
CviAII CATG 4 cut(s) 71, 301, 437, 470
CviQI GTAC 1 cut(s) 270
DpnI GATC 3 cut(s) 60, 75, 635
DpnII GATC 3 cut(s) 58, 73, 633
EciI GGCGGA 1 cut(s) 320
Eco130I CCWWGG 3 cut(s) 319, 436, 692
Eco147I AGGCCT 1 cut(s) 835
Eco47I GGWCC 1 cut(s) 259
Eco57I CTGAAG 1 cut(s) 143
Eco88I CYCGRG 1 cut(s) 824
EcoO109I RGGNCCY 1 cut(s) 259
EcoT14I CCWWGG 3 cut(s) 319, 436, 692
ErhI CCWWGG 3 cut(s) 319, 436, 692
FaeI CATG 4 cut(s) 74, 304, 440, 473
FaqI GGGAC 1 cut(s) 499
FatI CATG 4 cut(s) 70, 300, 436, 469
FblI GTMKAC 1 cut(s) 21
Fnu4HI GCNGC 3 cut(s) 49, 527, 777
FokI GGATG 2 cut(s) 584, 714
Fsp4HI GCNGC 3 cut(s) 49, 527, 777
FspBI CTAG 4 cut(s) 492, 656, 728, 743
GluI GCNGC 3 cut(s) 49, 527, 777
GsaI CCCAGC 1 cut(s) 194
GsuI CTGGAG 1 cut(s) 741
HaeIII GGCC 2 cut(s) 823, 835
HapII CCGG 1 cut(s) 671
Hin1II CATG 4 cut(s) 74, 304, 440, 473
HindIII AAGCTT 1 cut(s) 464
HinfI GANTC 2 cut(s) 328, 456
HpaII CCGG 1 cut(s) 671
HphI GGTGA 2 cut(s) 172, 865
Hpy166II GTNNAC 3 cut(s) 22, 144, 538
Hpy188I TCNGA 4 cut(s) 55, 162, 277, 383
Hpy188III TCNNGA 6 cut(s) 38, 71, 198, 470, 671, 680
Hpy8I GTNNAC 3 cut(s) 22, 144, 538
HpyAV CCTTC 3 cut(s) 250, 642, 860
HpyCH4IV ACGT 2 cut(s) 43, 378
HpyCH4V TGCA 3 cut(s) 167, 479, 511
HpyF10VI GCNNNNNNNGC 1 cut(s) 602
HpySE526I ACGT 2 cut(s) 43, 378
Hsp92II CATG 4 cut(s) 74, 304, 440, 473
Kpn2I TCCGGA 1 cut(s) 670
KpnI GGTACC 1 cut(s) 273
Kzo9I GATC 3 cut(s) 58, 73, 633
Lsp1109I GCAGC 3 cut(s) 60, 538, 788
MaeI CTAG 4 cut(s) 492, 656, 728, 743
MaeII ACGT 2 cut(s) 43, 378
MalI GATC 3 cut(s) 60, 75, 635
MboI GATC 3 cut(s) 58, 73, 633
MboII GAAGA 5 cut(s) 302, 527, 657, 659, 718
MfeI CAATTG 1 cut(s) 387
MluCI AATT 9 cut(s) 103, 111, 227, 285, 296, 387, 474, 627, 873
MmeI TCCRAC 1 cut(s) 843
MnlI CCTC 8 cut(s) 194, 283, 488, 667, 671, 751, 766, 825
MroI TCCGGA 1 cut(s) 670
MroXI GAANNNNTTC 2 cut(s) 465, 561
MseI TTAA 2 cut(s) 791, 839
MspI CCGG 1 cut(s) 671
MunI CAATTG 1 cut(s) 387
Mva1269I GAATGC 2 cut(s) 524, 617
MwoI GCNNNNNNNGC 1 cut(s) 602
NcoI CCATGG 1 cut(s) 436
NdeII GATC 3 cut(s) 58, 73, 633
NlaIII CATG 4 cut(s) 74, 304, 440, 473
NlaIV GGNNCC 3 cut(s) 241, 271, 653
NspV TTCGAA 1 cut(s) 459
PagI TCATGA 2 cut(s) 70, 469
PceI AGGCCT 1 cut(s) 835
PctI GAATGC 2 cut(s) 524, 617
PdmI GAANNNNTTC 2 cut(s) 465, 561
PfeI GAWTC 2 cut(s) 328, 456
PkrI GCNGC 3 cut(s) 50, 528, 778
PpuMI RGGWCCY 1 cut(s) 259
PsiI TTATAA 1 cut(s) 219
Psp5II RGGWCCY 1 cut(s) 259
PspFI CCCAGC 1 cut(s) 190
PspN4I GGNNCC 3 cut(s) 241, 271, 653
PspPI GGNCC 2 cut(s) 259, 822
PspPPI RGGWCCY 1 cut(s) 259
RsaI GTAC 1 cut(s) 271
RsaNI GTAC 1 cut(s) 270
SaqAI TTAA 2 cut(s) 791, 839
SatI GCNGC 3 cut(s) 49, 527, 777
Sau3AI GATC 3 cut(s) 58, 73, 633
Sau96I GGNCC 2 cut(s) 259, 822
SfuI TTCGAA 1 cut(s) 459
SinI GGWCC 1 cut(s) 259
SmlI CTYRAG 1 cut(s) 419
SmoI CTYRAG 1 cut(s) 419
Sse9I AATT 9 cut(s) 103, 111, 227, 285, 296, 387, 474, 627, 873
SseBI AGGCCT 1 cut(s) 835
SsiI CCGC 1 cut(s) 305
SspI AATATT 1 cut(s) 562
SspMI CTAG 4 cut(s) 492, 656, 728, 743
StuI AGGCCT 1 cut(s) 835
StyI CCWWGG 3 cut(s) 319, 436, 692
TaiI ACGT 2 cut(s) 46, 381
TaqI TCGA 2 cut(s) 86, 459
TasI AATT 9 cut(s) 103, 111, 227, 285, 296, 387, 474, 627, 873
TfiI GAWTC 2 cut(s) 328, 456
Tru1I TTAA 2 cut(s) 791, 839
Tru9I TTAA 2 cut(s) 791, 839
TscAI CASTG 1 cut(s) 258
TseI GCWGC 3 cut(s) 48, 526, 776
TspDTI ATGAA 4 cut(s) 289, 320, 458, 486
TspRI CASTG 1 cut(s) 258
VpaK11BI GGWCC 1 cut(s) 259
XapI RAATTY 2 cut(s) 227, 873
XcmI CCANNNNNNNNNTGG 1 cut(s) 699
XmiI GTMKAC 1 cut(s) 21
XmnI GAANNNNTTC 2 cut(s) 465, 561
XspI CTAG 4 cut(s) 492, 656, 728, 743
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.