Rmu_co8399019.1_g000001

Chromosome-associated kinesin

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8399019.1
Physical Location & Seq
Forward (+)
251 .. 1034
784 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8399019.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
atgatgaagaaggccaaccgccgctccaagcagaccgccgacgcgtccgccgcccccgacgattgccagaagcgagttcgcgaactcgaaatcgaaaacaaagcctttcagaaggaggttgaggagctgagatacaagcttgcaaatgtttcatctactagtggtgtggagaacagtgctcagaaactcagagaaaactacctgcagaagttgactttcctcgaagatcaggttacggtgttgacgaggaagctagatgctcagtctcaactctcaacccaaagaagaagaggggacgagtcagcaaagccgttccagtttgagattcagagattgaaggctcagaaggtgacacttatcttatcaattgtgcttgttactgtgaaatatagttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

15.08

Weight (kDa)

9.75

Isoelectric Point (pI)

49.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000316)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G33300
fragaria_vesca FvH4_3g26472 FvH4_5g30650 FvH4_5g30650 FvH4_5g30650 FvH4_5g35240 FvH4_5g35240 FvH4_5g35240 FvH4_5g35240 FvH4_5g35240 FvH4_5g35250 FvH4_5g35250 FvH4_5g35250 FvH4_5g35250 FvH4_5g35250 FvH4_5g35250 FvH4_5g35250 FvH4_5g35250
malus_domestica MD08G1198100.v1.1 MD08G1222000.v1.1 MD15G1385400.v1.1 MD15G1440800.v1.1
prunus_persica Prupe.1G532100_v2.0.a1 Prupe.1G559800_v2.0.a1 Prupe.1G559800_v2.0.a1 Prupe.1G559800_v2.0.a1 Prupe.1G559800_v2.0.a1
pyrus_communis pycom08g17030 pycom08g17040 pycom08g19270 pycom08g19280 pycom15g34550 pycom15g36860 pycom15g38860
rosa_chinensis RchiOBHm_Chr6g0258571 RchiOBHm_Chr6g0258581 RchiOBHm_Chr6g0258621 RchiOBHm_Chr7g0225511 RchiOBHm_Chr7g0230561 RchiOBHm_Chr7g0230571 RchiOBHm_Chr7g0236371 RchiOBHm_Chr7g0236391
rosa_laevigata RLG00000001080 RLG00000001810 RLG00000014605
rosa_multiflora Rmu_co8399019.1_g000001 Rmu_sc0002222.1_g000016 Rmu_sc0002449.1_g000032 Rmu_sc0003720.1_g000005 Rmu_sc0005578.1_g000003 Rmu_sc0011035.1_g000002 Rmu_sc0012681.1_g000001 Rmu_sc0023362.1_g000001 Rmu_sc0023858.1_g000001 Rmu_sc0029314.1_g000001
rosa_roxburghii Rroxscaffold_178G00437500 Rroxscaffold_178G00437540 Rroxscaffold_3G00225100 Rroxscaffold_3G00225110 Rroxscaffold_3G00225140 Rroxscaffold_3G00225170 Rroxscaffold_3G00225190 Rroxscaffold_3G00229880 Rroxscaffold_3G00233730 Rroxscaffold_7G00205760 Rroxscaffold_7G00205780 Rroxscaffold_7G00205820 Rroxscaffold_7G00205860
rosa_rugosa Rorug03G0221800 Rorug03G0270500 Rorug05G0313300 Rorug05G0582400 Rorug05G0582500 Rorug07G0230200.1 Rorug07G0230300 Rorug07G0230400 Rorug07G0295100 Rorug07G0296900
rosa_samantha Rh6AG098800 Rh6AG098900 Rh6AG184000 Rh6BG090700 Rh6BG090900 Rh6CG087500 Rh6CG087600 Rh6DG081800 Rh6DG082000 Rh7AG373100 Rh7AG412900 Rh7AG413000 Rh7AG451100 Rh7AG451200 Rh7BG364900 Rh7BG422800 Rh7BG422900 Rh7CG391400 Rh7CG431300 Rh7CG431400 Rh7CG469300 Rh7CG470800 Rh7CG471300 Rh7CG471400 Rh7DG367900 Rh7DG368000 Rh7DG375800 Rh7DG408800 Rh7DG440500 Rh7DG440600
rosa_wichuraiana Rw0G007810 Rw6G008570 Rw6G008580 Rw7G031720 Rw7G034090 Rw7G037500 Rw7G037510 Rw7G037580

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 210
AccBSI CCGCTC 1 cut(s) 24
AccII CGCG 2 cut(s) 44, 81
AciI CCGC 5 cut(s) 19, 22, 36, 48, 51
AflIII ACRYGT 1 cut(s) 42
AgsI TTSAA 1 cut(s) 337
AhlI ACTAGT 1 cut(s) 158
AluBI AGCT 3 cut(s) 127, 139, 253
AluI AGCT 3 cut(s) 127, 139, 253
Alw21I GWGCWC 1 cut(s) 181
Alw26I GTCTC 1 cut(s) 270
AoxI GGCC 1 cut(s) 12
AsuHPI GGTGA 1 cut(s) 361
Bbv12I GWGCWC 1 cut(s) 181
BceAI ACGGC 1 cut(s) 295
BcoDI GTCTC 1 cut(s) 270
BcuI ACTAGT 1 cut(s) 158
BfaI CTAG 2 cut(s) 159, 254
BfmI CTRYAG 1 cut(s) 203
BfuAI ACCTGC 1 cut(s) 210
BisI GCNGC 2 cut(s) 22, 51
BlsI GCNGC 2 cut(s) 23, 52
BmsI GCATC 1 cut(s) 247
BsaXI ACNNNNNCTCC 2 cut(s) 8, 38
Bse1I ACTGG 1 cut(s) 316
BseMII CTCAG 5 cut(s) 119, 194, 202, 275, 356
BseNI ACTGG 1 cut(s) 316
BseRI GAGGAG 1 cut(s) 137
Bsh1236I CGCG 2 cut(s) 44, 81
BshFI GGCC 1 cut(s) 14
BsiHKAI GWGCWC 1 cut(s) 181
BslFI GGGAC 1 cut(s) 308
BsmAI GTCTC 1 cut(s) 270
BsmFI GGGAC 1 cut(s) 308
BsnI GGCC 1 cut(s) 14
Bsp1286I GDGCHC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 226
Bsp68I TCGCGA 1 cut(s) 81
BspACI CCGC 5 cut(s) 19, 22, 36, 48, 51
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 5 cut(s) 120, 193, 201, 274, 355
BspFNI CGCG 2 cut(s) 44, 81
BspMAI CTGCAG 1 cut(s) 207
BspMI ACCTGC 1 cut(s) 210
BsrBI CCGCTC 1 cut(s) 24
BsrI ACTGG 1 cut(s) 316
BssMI GATC 1 cut(s) 226
Bst4CI ACNGT 3 cut(s) 176, 238, 382
Bst6I CTCTTC 1 cut(s) 283
BstC8I GCNNGC 1 cut(s) 141
BstDEI CTNAG 5 cut(s) 128, 180, 188, 261, 342
BstFNI CGCG 2 cut(s) 44, 81
BstKTI GATC 1 cut(s) 229
BstMAI GTCTC 1 cut(s) 270
BstMBI GATC 1 cut(s) 226
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstSFI CTRYAG 1 cut(s) 203
BstUI CGCG 2 cut(s) 44, 81
BsuRI GGCC 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 181
BtuMI TCGCGA 1 cut(s) 81
BveI ACCTGC 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 141
CseI GACGC 2 cut(s) 33, 50
CviJI RGCY 7 cut(s) 14, 104, 127, 139, 253, 310, 341
CviKI_1 RGCY 7 cut(s) 14, 104, 127, 139, 253, 310, 341
DdeI CTNAG 5 cut(s) 128, 180, 188, 261, 342
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
Eam1104I CTCTTC 1 cut(s) 283
EarI CTCTTC 1 cut(s) 283
EciI GGCGGA 1 cut(s) 37
FaiI YATR 1 cut(s) 390
FaqI GGGAC 1 cut(s) 308
Fnu4HI GCNGC 2 cut(s) 22, 51
Fsp4HI GCNGC 2 cut(s) 22, 51
FspBI CTAG 2 cut(s) 159, 254
GluI GCNGC 2 cut(s) 22, 51
HaeIII GGCC 1 cut(s) 14
HgaI GACGC 2 cut(s) 33, 50
HincII GTYRAC 2 cut(s) 213, 243
HindII GTYRAC 2 cut(s) 213, 243
HindIII AAGCTT 1 cut(s) 137
HinfI GANTC 2 cut(s) 299, 325
HphI GGTGA 1 cut(s) 361
Hpy166II GTNNAC 2 cut(s) 213, 243
Hpy188I TCNGA 5 cut(s) 111, 183, 191, 330, 345
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 2 cut(s) 213, 243
Hpy99I CGWCG 2 cut(s) 44, 62
HpyAV CCTTC 4 cut(s) 4, 106, 331, 340
HpyCH4III ACNGT 3 cut(s) 176, 238, 382
HpyCH4V TGCA 2 cut(s) 143, 205
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 5 cut(s) 128, 180, 188, 261, 342
Kzo9I GATC 1 cut(s) 226
LmnI GCTCC 2 cut(s) 29, 124
LpnPI CCDG 4 cut(s) 80, 215, 215, 329
LweI GCATC 1 cut(s) 247
MaeI CTAG 2 cut(s) 159, 254
MaeIII GTNAC 3 cut(s) 232, 349, 376
MalI GATC 1 cut(s) 228
MbiI CCGCTC 1 cut(s) 24
MboI GATC 1 cut(s) 226
MboII GAAGA 4 cut(s) 19, 236, 297, 300
MfeI CAATTG 1 cut(s) 366
MhlI GDGCHC 1 cut(s) 181
MluCI AATT 1 cut(s) 366
MluI ACGCGT 1 cut(s) 42
MlyI GAGTC 1 cut(s) 308
MnlI CCTC 5 cut(s) 109, 115, 230, 240, 284
MseI TTAA 1 cut(s) 394
MunI CAATTG 1 cut(s) 366
MvnI CGCG 2 cut(s) 44, 81
MwoI GCNNNNNNNGC 1 cut(s) 50
NdeII GATC 1 cut(s) 226
NmuCI GTSAC 1 cut(s) 349
NruI TCGCGA 1 cut(s) 81
PcsI WCGNNNNNNNCGW 1 cut(s) 242
PfeI GAWTC 1 cut(s) 325
PkrI GCNGC 2 cut(s) 23, 52
PleI GAGTC 1 cut(s) 307
PpsI GAGTC 1 cut(s) 307
PstI CTGCAG 1 cut(s) 207
RruI TCGCGA 1 cut(s) 81
SaqAI TTAA 1 cut(s) 394
SatI GCNGC 2 cut(s) 22, 51
Sau3AI GATC 1 cut(s) 226
SchI GAGTC 1 cut(s) 308
SduI GDGCHC 1 cut(s) 181
SetI ASST 7 cut(s) 120, 129, 141, 204, 234, 255, 351
SfaNI GCATC 1 cut(s) 247
SfcI CTRYAG 1 cut(s) 203
SpeI ACTAGT 1 cut(s) 158
Sse9I AATT 1 cut(s) 366
SsiI CCGC 5 cut(s) 19, 22, 36, 48, 51
SspMI CTAG 2 cut(s) 159, 254
TaaI ACNGT 3 cut(s) 176, 238, 382
TaqI TCGA 3 cut(s) 87, 93, 222
TasI AATT 1 cut(s) 366
TauI GCSGC 2 cut(s) 24, 53
TfiI GAWTC 1 cut(s) 325
Tru1I TTAA 1 cut(s) 394
Tru9I TTAA 1 cut(s) 394
TscAI CASTG 1 cut(s) 181
TseFI GTSAC 1 cut(s) 349
Tsp45I GTSAC 1 cut(s) 349
TspDTI ATGAA 2 cut(s) 20, 141
TspRI CASTG 1 cut(s) 181
XspI CTAG 2 cut(s) 159, 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.