Rmu_sc0000531.1_g000007

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000531.1
OG0000976
Physical Location & Seq
Forward (+)
40209 .. 40718
510 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000531.1_g000007.1.cds

Sequence Viewer

Length: 510 bp
atgttcagagctgagaggctctatgagctttatgaagaagttgagaattgcgaaaattctgaacgattagaaaaactaatcgaagaaatgaaaaaattcaattcaggaaaggaaagaaatctccttccctaccaggatattgaaatggaagaaggagagagctcaaaaacttccatcattcgagaaaggggaaagattaaactccctatacaaaaggcccctacgggcagaaatggagaaagaaattctcaaagatttgtcctagaggacaagatacccagagtaccaatttccaactatggaatttggctagatctggataaagctctagacaagagaaaaactcttgaccaatgggtagacagcctgatgatggcctctgctcttacccttggaaaatttgaagcccctgatattcatatgtactttgaaactactctcacttttcaaagagacagccagaggaaaagagtggctggaagaaatcaagacttcaaagtctccgtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

169

Amino Acids

19.91

Weight (kDa)

6.65

Isoelectric Point (pI)

33.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 497
AccI GTMKAC 1 cut(s) 360
AcsI RAATTY 5 cut(s) 55, 95, 244, 303, 398
AfaI GTAC 2 cut(s) 285, 425
AfiI CCNNNNNNNGG 1 cut(s) 373
AgsI TTSAA 6 cut(s) 100, 143, 404, 431, 449, 496
AjnI CCWGG 1 cut(s) 132
AluBI AGCT 4 cut(s) 11, 28, 162, 326
AluI AGCT 4 cut(s) 11, 28, 162, 326
Alw21I GWGCWC 1 cut(s) 164
Alw26I GTCTC 2 cut(s) 447, 505
AoxI GGCC 2 cut(s) 216, 375
ApoI RAATTY 5 cut(s) 55, 95, 244, 303, 398
Asp700I GAANNNNTTC 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 217
BanII GRGCYC 1 cut(s) 164
Bbv12I GWGCWC 1 cut(s) 164
BccI CCATC 2 cut(s) 182, 367
BciT130I CCWGG 1 cut(s) 134
BcoDI GTCTC 2 cut(s) 447, 505
BfaI CTAG 3 cut(s) 263, 311, 329
BglII AGATCT 1 cut(s) 313
Bme1390I CCNGG 1 cut(s) 134
BmgT120I GGNCC 1 cut(s) 217
BmiI GGNNCC 1 cut(s) 219
BmrFI CCNGG 1 cut(s) 134
BplI GAGNNNNNCTC 2 cut(s) 328, 360
BsaJI CCNNGG 1 cut(s) 391
Bsc4I CCNNNNNNNGG 1 cut(s) 373
BseBI CCWGG 1 cut(s) 134
BseDI CCNNGG 1 cut(s) 391
BseLI CCNNNNNNNGG 1 cut(s) 373
BshFI GGCC 2 cut(s) 218, 377
BsiHKAI GWGCWC 1 cut(s) 164
BslI CCNNNNNNNGG 1 cut(s) 373
BsmAI GTCTC 2 cut(s) 447, 505
BsnI GGCC 2 cut(s) 218, 377
Bsp1286I GDGCHC 1 cut(s) 164
Bsp143I GATC 1 cut(s) 313
BspANI GGCC 2 cut(s) 218, 377
BspCNI CTCAG 1 cut(s) 4
BspLI GGNNCC 1 cut(s) 219
BssECI CCNNGG 1 cut(s) 391
BssMI GATC 1 cut(s) 313
BssT1I CCWWGG 1 cut(s) 391
Bst2UI CCWGG 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 12
BstKTI GATC 1 cut(s) 316
BstMAI GTCTC 2 cut(s) 447, 505
BstMBI GATC 1 cut(s) 313
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstNI CCWGG 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 132
BstX2I RGATCY 1 cut(s) 313
BstYI RGATCY 1 cut(s) 313
BsuRI GGCC 2 cut(s) 218, 377
Cfr13I GGNCC 1 cut(s) 217
Csp6I GTAC 2 cut(s) 284, 424
CviQI GTAC 2 cut(s) 284, 424
DdeI CTNAG 1 cut(s) 12
DpnI GATC 1 cut(s) 315
DpnII GATC 1 cut(s) 313
DrdI GACNNNNNNGTC 1 cut(s) 497
DseDI GACNNNNNNGTC 1 cut(s) 497
Ecl136II GAGCTC 1 cut(s) 162
Eco130I CCWWGG 1 cut(s) 391
Eco24I GRGCYC 1 cut(s) 164
Eco53kI GAGCTC 1 cut(s) 162
EcoICRI GAGCTC 1 cut(s) 162
EcoO109I RGGNCCY 1 cut(s) 217
EcoRII CCWGG 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 391
EcoT38I GRGCYC 1 cut(s) 164
ErhI CCWWGG 1 cut(s) 391
FaiI YATR 7 cut(s) 24, 33, 209, 300, 420, 422, 508
FauNDI CATATG 1 cut(s) 420
FblI GTMKAC 1 cut(s) 360
FriOI GRGCYC 1 cut(s) 164
FspBI CTAG 3 cut(s) 263, 311, 329
HaeIII GGCC 2 cut(s) 218, 377
Hpy166II GTNNAC 1 cut(s) 361
Hpy188I TCNGA 2 cut(s) 8, 61
Hpy188III TCNNGA 6 cut(s) 105, 182, 317, 329, 347, 488
Hpy8I GTNNAC 1 cut(s) 361
HpyAV CCTTC 2 cut(s) 134, 146
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
HpyF3I CTNAG 1 cut(s) 12
Kzo9I GATC 1 cut(s) 313
LpnPI CCDG 9 cut(s) 90, 119, 146, 292, 302, 380, 423, 462, 473
MaeI CTAG 3 cut(s) 263, 311, 329
MalI GATC 1 cut(s) 315
MboI GATC 1 cut(s) 313
MboII GAAGA 4 cut(s) 47, 95, 161, 492
MflI RGATCY 1 cut(s) 313
MhlI GDGCHC 1 cut(s) 164
MluCI AATT 8 cut(s) 46, 55, 95, 100, 244, 288, 303, 398
MmeI TCCRAC 1 cut(s) 318
MnlI CCTC 4 cut(s) 9, 259, 388, 456
MroXI GAANNNNTTC 1 cut(s) 95
MseI TTAA 1 cut(s) 198
MspR9I CCNGG 1 cut(s) 134
MvaI CCWGG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 25
NdeI CATATG 1 cut(s) 420
NdeII GATC 1 cut(s) 313
NlaIV GGNNCC 1 cut(s) 219
PdmI GAANNNNTTC 1 cut(s) 95
Psp124BI GAGCTC 1 cut(s) 164
Psp6I CCWGG 1 cut(s) 132
PspGI CCWGG 1 cut(s) 132
PspN4I GGNNCC 1 cut(s) 219
PspPI GGNCC 1 cut(s) 217
PsuI RGATCY 1 cut(s) 313
RsaI GTAC 2 cut(s) 285, 425
RsaNI GTAC 2 cut(s) 284, 424
SacI GAGCTC 1 cut(s) 164
SaqAI TTAA 1 cut(s) 198
Sau3AI GATC 1 cut(s) 313
Sau96I GGNCC 1 cut(s) 217
ScrFI CCNGG 1 cut(s) 134
SduI GDGCHC 1 cut(s) 164
SetI ASST 4 cut(s) 13, 30, 164, 328
Sse9I AATT 8 cut(s) 46, 55, 95, 100, 244, 288, 303, 398
SspMI CTAG 3 cut(s) 263, 311, 329
SstI GAGCTC 1 cut(s) 164
StyD4I CCNGG 1 cut(s) 132
StyI CCWWGG 1 cut(s) 391
TaqI TCGA 2 cut(s) 81, 181
TasI AATT 8 cut(s) 46, 55, 95, 100, 244, 288, 303, 398
TatI WGTACW 1 cut(s) 423
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TspDTI ATGAA 3 cut(s) 48, 104, 407
TspGWI ACGGA 1 cut(s) 493
XapI RAATTY 5 cut(s) 55, 95, 244, 303, 398
XbaI TCTAGA 1 cut(s) 328
XmiI GTMKAC 1 cut(s) 360
XmnI GAANNNNTTC 1 cut(s) 95
XspI CTAG 3 cut(s) 263, 311, 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.