Rmu_sc0000855.1_g000012

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000855.1
OG0000976
Physical Location & Seq
Forward (+)
50916 .. 52694
1779 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000855.1_g000012.1.cds

Sequence Viewer

Length: 993 bp
atgagcaccacagtagagccaaagacacggatctccaacatccctggtcttactactggattcctcaccagtcgaaagaaccattcacaacagattcacaaggttacttggaatgaggtaacttttcctattgaatggaaattatctggtccaaagctaccagcagagaatgcaaaagctaaaatttatgaaagtagaaagactggagaaatcagtctaaattttgacaatcacagaaaaagtgatgtcggtcctgagaatctcaggataaacaggaatcttctcagaagaagctacagcactagagaagctagtgtcagtggtacaaaacccactattgaagatcctattactggagaagaactggaagctgatctaaacagaccagtccagatgttcagagctgagaagctctatgagctttatgaagaagctgagaattgcgaaaatcctgatcgattagaaaaactaatcgaagaaatgaaagaattcaaaatcagaaagacgagaaaagtctttccatatcaagatattgaaatggaagaaggagaaagctccagaacttccatcagtctagaaaagggaaagattaaactccctatacagaaggccccttcgggcagaaatggagaaagaaattctcaaagatttgtcccagaggacaagatacccagagtaccaatttccaactatggaatttggctagatctggataaagctctagacaagagaaaaactcttgaccaatgtgtagacagcctgatgatggcctctgctcttacccttggaaaatttgaagctcctgatcttcagatatctactaaagctctctttgaagaatatgagcaaatagtagaagtggcaaatatgaaaggctacgaaatagcctattctgatgatgaagatgacgacatgtcagtctattctgcctggtctgacgacatgtcagtctattctgcctgtgctgcacaatatatgccagctgaggaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

330

Amino Acids

37.8

Weight (kDa)

5.13

Isoelectric Point (pI)

44.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 917, 947
AccI GTMKAC 1 cut(s) 753
AclWI GGATC 2 cut(s) 38, 338
AcsI RAATTY 6 cut(s) 183, 220, 488, 637, 696, 791
AcuI CTGAAG 1 cut(s) 794
AfaI GTAC 2 cut(s) 325, 678
AfiI CCNNNNNNNGG 2 cut(s) 353, 766
AflIII ACRYGT 2 cut(s) 912, 942
AgsI TTSAA 6 cut(s) 134, 341, 493, 536, 797, 836
AhdI GACNNNNNGTC 2 cut(s) 913, 943
AjnI CCWGG 2 cut(s) 43, 929
Alw21I GWGCWC 1 cut(s) 8
AlwI GGATC 2 cut(s) 38, 338
AoxI GGCC 2 cut(s) 609, 768
ApeKI GCWGC 1 cut(s) 965
ApoI RAATTY 6 cut(s) 183, 220, 488, 637, 696, 791
Asp700I GAANNNNTTC 1 cut(s) 488
AspS9I GGNCC 3 cut(s) 149, 251, 610
AsuHPI GGTGA 1 cut(s) 58
AvaII GGWCC 2 cut(s) 149, 251
Bbv12I GWGCWC 1 cut(s) 8
BbvCI CCTCAGC 1 cut(s) 984
BbvI GCAGC 1 cut(s) 952
BccI CCATC 2 cut(s) 575, 760
BciT130I CCWGG 2 cut(s) 45, 931
BfaI CTAG 5 cut(s) 303, 312, 575, 704, 722
BfmI CTRYAG 1 cut(s) 295
BglII AGATCT 1 cut(s) 706
BisI GCNGC 1 cut(s) 966
BlsI GCNGC 1 cut(s) 967
Bme1390I CCNGG 2 cut(s) 45, 931
Bme18I GGWCC 2 cut(s) 149, 251
BmeRI GACNNNNNGTC 2 cut(s) 913, 943
BmgT120I GGNCC 3 cut(s) 149, 251, 610
BmiI GGNNCC 1 cut(s) 612
BmrFI CCNGG 2 cut(s) 45, 931
BplI GAGNNNNNCTC 2 cut(s) 721, 753
BpmI CTGGAG 3 cut(s) 225, 375, 541
Bpu10I CCTNAGC 1 cut(s) 984
Bsa29I ATCGAT 1 cut(s) 457
BsaJI CCNNGG 2 cut(s) 43, 784
Bsc4I CCNNNNNNNGG 2 cut(s) 353, 766
Bse1I ACTGG 6 cut(s) 61, 69, 208, 358, 369, 386
BseBI CCWGG 2 cut(s) 45, 931
BseCI ATCGAT 1 cut(s) 457
BseDI CCNNGG 2 cut(s) 43, 784
BseGI GGATG 1 cut(s) 39
BseLI CCNNNNNNNGG 2 cut(s) 353, 766
BseMII CTCAG 6 cut(s) 246, 277, 298, 396, 426, 975
BseNI ACTGG 6 cut(s) 61, 69, 208, 358, 369, 386
BseXI GCAGC 1 cut(s) 952
BsgI GTGCAG 1 cut(s) 951
BshFI GGCC 2 cut(s) 611, 770
BshVI ATCGAT 1 cut(s) 457
BsiHKAI GWGCWC 1 cut(s) 8
BslFI GGGAC 1 cut(s) 638
BslI CCNNNNNNNGG 2 cut(s) 353, 766
BsmFI GGGAC 1 cut(s) 638
BsmI GAATGC 1 cut(s) 175
BsnI GGCC 2 cut(s) 611, 770
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 6 cut(s) 30, 343, 373, 454, 706, 805
BspANI GGCC 2 cut(s) 611, 770
BspCNI CTCAG 6 cut(s) 247, 276, 297, 397, 427, 976
BspDI ATCGAT 1 cut(s) 457
BspLI GGNNCC 1 cut(s) 612
BspPI GGATC 2 cut(s) 38, 338
BsrI ACTGG 6 cut(s) 61, 69, 208, 358, 369, 386
BssECI CCNNGG 2 cut(s) 43, 784
BssMI GATC 6 cut(s) 30, 343, 373, 454, 706, 805
BssT1I CCWWGG 1 cut(s) 784
Bst2UI CCWGG 2 cut(s) 45, 931
Bst4CI ACNGT 1 cut(s) 13
BstAPI GCANNNNNTGC 1 cut(s) 170
BstC8I GCNNGC 1 cut(s) 981
BstDEI CTNAG 6 cut(s) 255, 263, 284, 405, 435, 984
BstF5I GGATG 1 cut(s) 39
BstKTI GATC 6 cut(s) 33, 346, 376, 457, 709, 808
BstMBI GATC 6 cut(s) 30, 343, 373, 454, 706, 805
BstMWI GCNNNNNNNGC 3 cut(s) 170, 418, 965
BstNI CCWGG 2 cut(s) 45, 931
BstNSI RCATGY 2 cut(s) 916, 946
BstSCI CCNGG 2 cut(s) 43, 929
BstSFI CTRYAG 1 cut(s) 295
BstV1I GCAGC 1 cut(s) 952
BstX2I RGATCY 3 cut(s) 30, 343, 706
BstYI RGATCY 3 cut(s) 30, 343, 706
Bsu15I ATCGAT 1 cut(s) 457
BsuRI GGCC 2 cut(s) 611, 770
BsuTUI ATCGAT 1 cut(s) 457
BtsCI GGATG 1 cut(s) 39
BtsIMutI CAGTG 1 cut(s) 325
Cac8I GCNNGC 1 cut(s) 981
Cfr13I GGNCC 3 cut(s) 149, 251, 610
ClaI ATCGAT 1 cut(s) 457
Csp6I GTAC 2 cut(s) 324, 677
CviAII CATG 2 cut(s) 913, 943
CviQI GTAC 2 cut(s) 324, 677
DdeI CTNAG 6 cut(s) 255, 263, 284, 405, 435, 984
DpnI GATC 6 cut(s) 32, 345, 375, 456, 708, 807
DpnII GATC 6 cut(s) 30, 343, 373, 454, 706, 805
DrdI GACNNNNNNGTC 2 cut(s) 917, 947
DriI GACNNNNNGTC 2 cut(s) 913, 943
DseDI GACNNNNNNGTC 2 cut(s) 917, 947
Eam1105I GACNNNNNGTC 2 cut(s) 913, 943
Eco130I CCWWGG 1 cut(s) 784
Eco32I GATATC 1 cut(s) 816
Eco47I GGWCC 2 cut(s) 149, 251
Eco57I CTGAAG 1 cut(s) 794
EcoO109I RGGNCCY 1 cut(s) 610
EcoRI GAATTC 1 cut(s) 488
EcoRII CCWGG 2 cut(s) 43, 929
EcoRV GATATC 1 cut(s) 816
EcoT14I CCWWGG 1 cut(s) 784
ErhI CCWWGG 1 cut(s) 784
FaeI CATG 2 cut(s) 916, 946
FaqI GGGAC 1 cut(s) 638
FatI CATG 2 cut(s) 912, 942
FblI GTMKAC 1 cut(s) 753
Fnu4HI GCNGC 1 cut(s) 966
FokI GGATG 1 cut(s) 26
Fsp4HI GCNGC 1 cut(s) 966
FspBI CTAG 5 cut(s) 303, 312, 575, 704, 722
GluI GCNGC 1 cut(s) 966
GsuI CTGGAG 3 cut(s) 225, 375, 541
HaeIII GGCC 2 cut(s) 611, 770
Hin1II CATG 2 cut(s) 916, 946
HinfI GANTC 4 cut(s) 60, 94, 259, 277
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 1 cut(s) 754
Hpy188I TCNGA 6 cut(s) 287, 401, 500, 813, 895, 937
Hpy8I GTNNAC 1 cut(s) 754
HpyAV CCTTC 3 cut(s) 539, 601, 624
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4V TGCA 2 cut(s) 173, 968
HpyF10VI GCNNNNNNNGC 3 cut(s) 170, 418, 965
HpyF3I CTNAG 6 cut(s) 255, 263, 284, 405, 435, 984
Hsp92II CATG 2 cut(s) 916, 946
Kzo9I GATC 6 cut(s) 30, 343, 373, 454, 706, 805
LmnI GCTCC 2 cut(s) 560, 805
Lsp1109I GCAGC 1 cut(s) 952
MaeI CTAG 5 cut(s) 303, 312, 575, 704, 722
MaeIII GTNAC 2 cut(s) 103, 118
MalI GATC 6 cut(s) 32, 345, 375, 456, 708, 807
MboI GATC 6 cut(s) 30, 343, 373, 454, 706, 805
MflI RGATCY 3 cut(s) 30, 343, 706
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 9 cut(s) 140, 183, 220, 439, 488, 637, 681, 696, 791
MmeI TCCRAC 2 cut(s) 60, 711
MnlI CCTC 5 cut(s) 74, 109, 652, 781, 979
MroXI GAANNNNTTC 1 cut(s) 488
MseI TTAA 1 cut(s) 591
MspA1I CMGCKG 1 cut(s) 983
MspR9I CCNGG 2 cut(s) 45, 931
Mva1269I GAATGC 1 cut(s) 175
MvaI CCWGG 2 cut(s) 45, 931
MwoI GCNNNNNNNGC 3 cut(s) 170, 418, 965
NdeII GATC 6 cut(s) 30, 343, 373, 454, 706, 805
NlaIII CATG 2 cut(s) 916, 946
NlaIV GGNNCC 1 cut(s) 612
NspI RCATGY 2 cut(s) 916, 946
PciI ACATGT 2 cut(s) 912, 942
PctI GAATGC 1 cut(s) 175
PdmI GAANNNNTTC 1 cut(s) 488
PfeI GAWTC 4 cut(s) 60, 94, 259, 277
PkrI GCNGC 1 cut(s) 967
PscI ACATGT 2 cut(s) 912, 942
Psp6I CCWGG 2 cut(s) 43, 929
PspGI CCWGG 2 cut(s) 43, 929
PspN4I GGNNCC 1 cut(s) 612
PspPI GGNCC 3 cut(s) 149, 251, 610
PsuI RGATCY 3 cut(s) 30, 343, 706
PvuII CAGCTG 1 cut(s) 983
RsaI GTAC 2 cut(s) 325, 678
RsaNI GTAC 2 cut(s) 324, 677
SaqAI TTAA 1 cut(s) 591
SatI GCNGC 1 cut(s) 966
Sau3AI GATC 6 cut(s) 30, 343, 373, 454, 706, 805
Sau96I GGNCC 3 cut(s) 149, 251, 610
ScrFI CCNGG 2 cut(s) 45, 931
SduI GDGCHC 1 cut(s) 8
SfcI CTRYAG 1 cut(s) 295
SinI GGWCC 2 cut(s) 149, 251
Sse9I AATT 9 cut(s) 140, 183, 220, 439, 488, 637, 681, 696, 791
SspMI CTAG 5 cut(s) 303, 312, 575, 704, 722
StyD4I CCNGG 2 cut(s) 43, 929
StyI CCWWGG 1 cut(s) 784
TaaI ACNGT 1 cut(s) 13
TaqI TCGA 3 cut(s) 73, 457, 474
TaqII GACCGA 1 cut(s) 239
TasI AATT 9 cut(s) 140, 183, 220, 439, 488, 637, 681, 696, 791
TfiI GAWTC 4 cut(s) 60, 94, 259, 277
Tru1I TTAA 1 cut(s) 591
Tru9I TTAA 1 cut(s) 591
TscAI CASTG 1 cut(s) 325
TseI GCWGC 1 cut(s) 965
TspDTI ATGAA 5 cut(s) 204, 441, 497, 884, 915
TspGWI ACGGA 1 cut(s) 43
TspRI CASTG 1 cut(s) 325
VpaK11BI GGWCC 2 cut(s) 149, 251
XapI RAATTY 6 cut(s) 183, 220, 488, 637, 696, 791
XbaI TCTAGA 2 cut(s) 574, 721
XceI RCATGY 2 cut(s) 916, 946
XmiI GTMKAC 1 cut(s) 753
XmnI GAANNNNTTC 1 cut(s) 488
XspI CTAG 5 cut(s) 303, 312, 575, 704, 722
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.