Rmu_sc0007727.1_g000016

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007727.1
OG0000976
Physical Location & Seq
Reverse (-)
58075 .. 58950
876 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007727.1_g000016.1.cds

Sequence Viewer

Length: 876 bp
ctgctggattcctcaccagtcagaaaaaaccattcacaaaaaattcacaaggttacttggaatgaagtaacttttcctattgaatggaaattatctggtccgaagctaccagcagaaagtgcaatagctaaaatctacgaaagtagaaagactggagaaatcagtctaaattttgacaatcacagaaaaagtgatgtcggtcctgagaatctcaggataaacaggaatcttctcagaagaacctacagcactagagaagctagtgtaagtggtacaaaatccactattgaagatcctattactgaagaagaactggaagctgagctaaacagaccagtccagatgtttagagctaagaggctctatgagttttatgaagaagctgagaattgcgaaaatcctgatcgattagagaaactaatcgaagagataaaagaattcgaaatcagaaagacgagaaaagtctttccatatcaagatattgaaatggaagaaggagaaagctccagaacttccatcagtcgagaaaagggaaagattaaactccctatacagaaggcccctacgggcataaatggagaaagaaattctcaaagatttgtcccagaggacaagatacccagaggaccaatttccaactatggaatttggctagatctagataaagctctagacaagagaaaaactcttgaccaatgggtagacagcctgatgatggcctctactcttacccttggaaaatttgaagctcctgatcttcagatgtactttgaaactactctcaccggggtagcaaaaaagtattacttctctttcaaagacacagccagaggaaaagagtggctggaagaaatcaagacttcgaaatcttcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

291

Amino Acids

33.82

Weight (kDa)

7.87

Isoelectric Point (pI)

43.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 702
AclWI GGATC 1 cut(s) 287
AcsI RAATTY 6 cut(s) 42, 169, 437, 586, 645, 740
AcuI CTGAAG 2 cut(s) 324, 743
AfaI GTAC 2 cut(s) 274, 767
AfiI CCNNNNNNNGG 1 cut(s) 715
AgsI TTSAA 6 cut(s) 83, 290, 485, 746, 773, 817
AlwI GGATC 1 cut(s) 287
AoxI GGCC 2 cut(s) 558, 717
ApoI RAATTY 6 cut(s) 42, 169, 437, 586, 645, 740
AspS9I GGNCC 4 cut(s) 98, 200, 559, 626
AsuC2I CCSGG 1 cut(s) 787
AsuHPI GGTGA 2 cut(s) 6, 775
AsuII TTCGAA 2 cut(s) 441, 863
AvaII GGWCC 3 cut(s) 98, 200, 626
BccI CCATC 2 cut(s) 524, 709
BcnI CCSGG 1 cut(s) 787
BfaI CTAG 5 cut(s) 252, 261, 653, 659, 671
BfmI CTRYAG 1 cut(s) 244
BglII AGATCT 1 cut(s) 655
BlpI GCTNAGC 1 cut(s) 321
Bme1390I CCNGG 1 cut(s) 787
Bme18I GGWCC 3 cut(s) 98, 200, 626
BmgT120I GGNCC 4 cut(s) 98, 200, 559, 626
BmiI GGNNCC 1 cut(s) 561
BmrFI CCNGG 1 cut(s) 787
BplI GAGNNNNNCTC 2 cut(s) 670, 702
BpmI CTGGAG 2 cut(s) 174, 490
Bpu1102I GCTNAGC 1 cut(s) 321
Bpu14I TTCGAA 2 cut(s) 441, 863
BpuMI CCSGG 1 cut(s) 787
Bsa29I ATCGAT 1 cut(s) 406
BsaJI CCNNGG 2 cut(s) 733, 786
Bsc4I CCNNNNNNNGG 1 cut(s) 715
Bse1I ACTGG 4 cut(s) 17, 157, 318, 335
BseCI ATCGAT 1 cut(s) 406
BseDI CCNNGG 2 cut(s) 733, 786
BseLI CCNNNNNNNGG 1 cut(s) 715
BseMII CTCAG 5 cut(s) 195, 226, 247, 312, 375
BseNI ACTGG 4 cut(s) 17, 157, 318, 335
BshFI GGCC 2 cut(s) 560, 719
BshVI ATCGAT 1 cut(s) 406
BsiSI CCGG 1 cut(s) 786
BslFI GGGAC 1 cut(s) 587
BslI CCNNNNNNNGG 1 cut(s) 715
BsmFI GGGAC 1 cut(s) 587
BsnI GGCC 2 cut(s) 560, 719
Bsp119I TTCGAA 2 cut(s) 441, 863
Bsp143I GATC 4 cut(s) 292, 403, 655, 754
Bsp1720I GCTNAGC 1 cut(s) 321
BspANI GGCC 2 cut(s) 560, 719
BspCNI CTCAG 5 cut(s) 196, 225, 246, 313, 376
BspDI ATCGAT 1 cut(s) 406
BspLI GGNNCC 1 cut(s) 561
BspPI GGATC 1 cut(s) 287
BspT104I TTCGAA 2 cut(s) 441, 863
BsrI ACTGG 4 cut(s) 17, 157, 318, 335
BssECI CCNNGG 2 cut(s) 733, 786
BssMI GATC 4 cut(s) 292, 403, 655, 754
BssT1I CCWWGG 1 cut(s) 733
Bst6I CTCTTC 1 cut(s) 420
BstAPI GCANNNNNTGC 1 cut(s) 119
BstBI TTCGAA 2 cut(s) 441, 863
BstDEI CTNAG 6 cut(s) 204, 212, 233, 321, 354, 384
BstKTI GATC 4 cut(s) 295, 406, 658, 757
BstMBI GATC 4 cut(s) 292, 403, 655, 754
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 785
BstSFI CTRYAG 1 cut(s) 244
BstX2I RGATCY 2 cut(s) 292, 655
BstYI RGATCY 2 cut(s) 292, 655
Bsu15I ATCGAT 1 cut(s) 406
BsuRI GGCC 2 cut(s) 560, 719
BsuTUI ATCGAT 1 cut(s) 406
Cfr13I GGNCC 4 cut(s) 98, 200, 559, 626
ClaI ATCGAT 1 cut(s) 406
Csp6I GTAC 2 cut(s) 273, 766
CviQI GTAC 2 cut(s) 273, 766
DdeI CTNAG 6 cut(s) 204, 212, 233, 321, 354, 384
DpnI GATC 4 cut(s) 294, 405, 657, 756
DpnII GATC 4 cut(s) 292, 403, 655, 754
Eam1104I CTCTTC 1 cut(s) 420
EarI CTCTTC 1 cut(s) 420
Eco130I CCWWGG 1 cut(s) 733
Eco47I GGWCC 3 cut(s) 98, 200, 626
Eco57I CTGAAG 2 cut(s) 324, 743
EcoO109I RGGNCCY 1 cut(s) 559
EcoRI GAATTC 1 cut(s) 437
EcoT14I CCWWGG 1 cut(s) 733
ErhI CCWWGG 1 cut(s) 733
FaiI YATR 6 cut(s) 366, 375, 472, 551, 572, 642
FalI AAGNNNNNCTT 2 cut(s) 791, 823
FaqI GGGAC 1 cut(s) 587
FblI GTMKAC 1 cut(s) 702
FspBI CTAG 5 cut(s) 252, 261, 653, 659, 671
GsuI CTGGAG 2 cut(s) 174, 490
HaeIII GGCC 2 cut(s) 560, 719
HapII CCGG 1 cut(s) 786
HinfI GANTC 3 cut(s) 8, 208, 226
HpaII CCGG 1 cut(s) 786
HphI GGTGA 2 cut(s) 6, 775
Hpy166II GTNNAC 1 cut(s) 703
Hpy188I TCNGA 5 cut(s) 23, 102, 236, 449, 762
Hpy8I GTNNAC 1 cut(s) 703
HpyAV CCTTC 2 cut(s) 488, 550
HpyCH4V TGCA 1 cut(s) 122
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 6 cut(s) 204, 212, 233, 321, 354, 384
Kzo9I GATC 4 cut(s) 292, 403, 655, 754
LmnI GCTCC 2 cut(s) 509, 754
MaeI CTAG 5 cut(s) 252, 261, 653, 659, 671
MaeIII GTNAC 2 cut(s) 52, 67
MalI GATC 4 cut(s) 294, 405, 657, 756
MboI GATC 4 cut(s) 292, 403, 655, 754
MflI RGATCY 2 cut(s) 292, 655
MluCI AATT 9 cut(s) 42, 89, 169, 388, 437, 586, 630, 645, 740
MmeI TCCRAC 1 cut(s) 660
MnlI CCTC 6 cut(s) 22, 351, 601, 617, 730, 824
MseI TTAA 1 cut(s) 540
MspI CCGG 1 cut(s) 786
MspR9I CCNGG 1 cut(s) 787
MwoI GCNNNNNNNGC 1 cut(s) 119
NciI CCSGG 1 cut(s) 787
NdeII GATC 4 cut(s) 292, 403, 655, 754
NlaIV GGNNCC 1 cut(s) 561
NspV TTCGAA 2 cut(s) 441, 863
PcsI WCGNNNNNNNCGW 1 cut(s) 869
PfeI GAWTC 3 cut(s) 8, 208, 226
PspN4I GGNNCC 1 cut(s) 561
PspPI GGNCC 4 cut(s) 98, 200, 559, 626
PsuI RGATCY 2 cut(s) 292, 655
RsaI GTAC 2 cut(s) 274, 767
RsaNI GTAC 2 cut(s) 273, 766
SaqAI TTAA 1 cut(s) 540
Sau3AI GATC 4 cut(s) 292, 403, 655, 754
Sau96I GGNCC 4 cut(s) 98, 200, 559, 626
ScrFI CCNGG 1 cut(s) 787
SfcI CTRYAG 1 cut(s) 244
SfuI TTCGAA 2 cut(s) 441, 863
SinI GGWCC 3 cut(s) 98, 200, 626
Sse9I AATT 9 cut(s) 42, 89, 169, 388, 437, 586, 630, 645, 740
SspMI CTAG 5 cut(s) 252, 261, 653, 659, 671
StyD4I CCNGG 1 cut(s) 785
StyI CCWWGG 1 cut(s) 733
TaqI TCGA 5 cut(s) 406, 423, 441, 523, 863
TaqII GACCGA 1 cut(s) 188
TasI AATT 9 cut(s) 42, 89, 169, 388, 437, 586, 630, 645, 740
TatI WGTACW 1 cut(s) 765
TfiI GAWTC 3 cut(s) 8, 208, 226
Tru1I TTAA 1 cut(s) 540
Tru9I TTAA 1 cut(s) 540
TspDTI ATGAA 2 cut(s) 78, 390
VpaK11BI GGWCC 3 cut(s) 98, 200, 626
XapI RAATTY 6 cut(s) 42, 169, 437, 586, 645, 740
XbaI TCTAGA 2 cut(s) 658, 670
XmiI GTMKAC 1 cut(s) 702
XspI CTAG 5 cut(s) 252, 261, 653, 659, 671
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.