Rmu_sc0037776.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037776.1
OG0000976
Physical Location & Seq
Forward (+)
1 .. 811
811 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037776.1_g000001.1.cds

Sequence Viewer

Length: 623 bp
aagaagatctggaagctgatctaatcagaccagtccatatgctcagagctgagaggctctatgatctttatgaagaagctgagaattgtgaaaatcctgaacggttagaaaaactaatcgaagaaatgaaagaattcaaaatcagaaagacgagaaaagtctttccatatcaagatattgaaatggaagaaggagagagctccaagacttccatcgttcgagaaaagggaaaagtcaaactccctatacagaaggcccctacgggcagaaatggagaaagaaattctcaaagatttgtcccagaggacaagatacccagagtaccaatttccaattatggaatttggctagatctggataaagctattgacaagagaaaaactcttgaccaatgggtagacaacctaatgatggcctctgctcttacccttggaaaatttgaagctcctgatcttcagatgtactttgaaactactatcaccggggtagcaaaaaagtattacttctctttcaaggaaacagccagaggaaaagagtggctagaagaaatcaagacttcaaagtctccgtatgattttgcagtacccctgtacgatcagttctgtggagatctttcaaatcta
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

207

Amino Acids

24.27

Weight (kDa)

5.26

Isoelectric Point (pI)

35.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 561
AccI GTMKAC 1 cut(s) 398
AcsI RAATTY 4 cut(s) 133, 282, 341, 436
AcuI CTGAAG 1 cut(s) 439
AfaI GTAC 4 cut(s) 323, 463, 584, 592
AfiI CCNNNNNNNGG 1 cut(s) 411
AgsI TTSAA 7 cut(s) 138, 181, 442, 469, 513, 560, 617
AluBI AGCT 6 cut(s) 16, 49, 79, 200, 364, 445
AluI AGCT 6 cut(s) 16, 49, 79, 200, 364, 445
Alw21I GWGCWC 1 cut(s) 202
Alw26I GTCTC 1 cut(s) 569
AoxI GGCC 2 cut(s) 254, 413
ApoI RAATTY 4 cut(s) 133, 282, 341, 436
Asp700I GAANNNNTTC 1 cut(s) 133
AspS9I GGNCC 1 cut(s) 255
AsuC2I CCSGG 1 cut(s) 483
AsuHPI GGTGA 1 cut(s) 471
BanII GRGCYC 1 cut(s) 202
Bbv12I GWGCWC 1 cut(s) 202
BccI CCATC 2 cut(s) 220, 405
BcnI CCSGG 1 cut(s) 483
BcoDI GTCTC 1 cut(s) 569
BfaI CTAG 2 cut(s) 349, 541
BglII AGATCT 3 cut(s) 6, 351, 609
Bme1390I CCNGG 1 cut(s) 483
BmgT120I GGNCC 1 cut(s) 255
BmiI GGNNCC 1 cut(s) 257
BmrFI CCNGG 1 cut(s) 483
BplI GAGNNNNNCTC 2 cut(s) 366, 398
BpuMI CCSGG 1 cut(s) 483
BsaJI CCNNGG 2 cut(s) 429, 482
Bsc4I CCNNNNNNNGG 1 cut(s) 411
Bse1I ACTGG 1 cut(s) 31
BseDI CCNNGG 2 cut(s) 429, 482
BseLI CCNNNNNNNGG 1 cut(s) 411
BseMII CTCAG 3 cut(s) 41, 57, 71
BseNI ACTGG 1 cut(s) 31
BshFI GGCC 2 cut(s) 256, 415
BsiHKAI GWGCWC 1 cut(s) 202
BsiSI CCGG 1 cut(s) 482
BslFI GGGAC 1 cut(s) 283
BslI CCNNNNNNNGG 1 cut(s) 411
BsmAI GTCTC 1 cut(s) 569
BsmFI GGGAC 1 cut(s) 283
BsnI GGCC 2 cut(s) 256, 415
Bsp1286I GDGCHC 1 cut(s) 202
Bsp143I GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
BspANI GGCC 2 cut(s) 256, 415
BspCNI CTCAG 3 cut(s) 42, 56, 72
BspLI GGNNCC 1 cut(s) 257
BsrI ACTGG 1 cut(s) 31
BssECI CCNNGG 2 cut(s) 429, 482
BssMI GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
BssT1I CCWWGG 1 cut(s) 429
Bst4CI ACNGT 1 cut(s) 104
BstDEI CTNAG 3 cut(s) 43, 50, 80
BstKTI GATC 7 cut(s) 9, 21, 66, 354, 453, 597, 612
BstMAI GTCTC 1 cut(s) 569
BstMBI GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
BstSCI CCNGG 1 cut(s) 481
BstX2I RGATCY 3 cut(s) 6, 351, 609
BstYI RGATCY 3 cut(s) 6, 351, 609
BsuRI GGCC 2 cut(s) 256, 415
Cfr13I GGNCC 1 cut(s) 255
Csp6I GTAC 4 cut(s) 322, 462, 583, 591
CviQI GTAC 4 cut(s) 322, 462, 583, 591
DdeI CTNAG 3 cut(s) 43, 50, 80
DpnI GATC 7 cut(s) 8, 20, 65, 353, 452, 596, 611
DpnII GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
DrdI GACNNNNNNGTC 1 cut(s) 561
DseDI GACNNNNNNGTC 1 cut(s) 561
Ecl136II GAGCTC 1 cut(s) 200
Eco130I CCWWGG 1 cut(s) 429
Eco24I GRGCYC 1 cut(s) 202
Eco53kI GAGCTC 1 cut(s) 200
Eco57I CTGAAG 1 cut(s) 439
EcoICRI GAGCTC 1 cut(s) 200
EcoO109I RGGNCCY 1 cut(s) 255
EcoRI GAATTC 1 cut(s) 133
EcoT14I CCWWGG 1 cut(s) 429
EcoT38I GRGCYC 1 cut(s) 202
ErhI CCWWGG 1 cut(s) 429
FaiI YATR 8 cut(s) 38, 40, 62, 71, 168, 247, 338, 572
FalI AAGNNNNNCTT 2 cut(s) 487, 519
FaqI GGGAC 1 cut(s) 283
FauNDI CATATG 1 cut(s) 38
FblI GTMKAC 1 cut(s) 398
FriOI GRGCYC 1 cut(s) 202
FspBI CTAG 2 cut(s) 349, 541
HaeIII GGCC 2 cut(s) 256, 415
HapII CCGG 1 cut(s) 482
HpaII CCGG 1 cut(s) 482
HphI GGTGA 1 cut(s) 471
Hpy166II GTNNAC 1 cut(s) 399
Hpy188I TCNGA 4 cut(s) 28, 46, 145, 458
Hpy188III TCNNGA 8 cut(s) 10, 97, 172, 220, 355, 385, 448, 552
Hpy8I GTNNAC 1 cut(s) 399
HpyAV CCTTC 2 cut(s) 184, 246
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 580
HpyF3I CTNAG 3 cut(s) 43, 50, 80
Kzo9I GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
LmnI GCTCC 2 cut(s) 205, 450
LpnPI CCDG 9 cut(s) 44, 110, 314, 330, 340, 461, 495, 537, 601
MaeI CTAG 2 cut(s) 349, 541
MalI GATC 7 cut(s) 8, 20, 65, 353, 452, 596, 611
MboI GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
MboII GAAGA 6 cut(s) 16, 85, 133, 199, 445, 556
MflI RGATCY 3 cut(s) 6, 351, 609
MhlI GDGCHC 1 cut(s) 202
MluCI AATT 7 cut(s) 84, 133, 282, 326, 333, 341, 436
MnlI CCTC 4 cut(s) 47, 297, 426, 520
MroXI GAANNNNTTC 1 cut(s) 133
MspI CCGG 1 cut(s) 482
MspR9I CCNGG 1 cut(s) 483
NciI CCSGG 1 cut(s) 483
NdeI CATATG 1 cut(s) 38
NdeII GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
NlaIV GGNNCC 1 cut(s) 257
PdmI GAANNNNTTC 1 cut(s) 133
Psp124BI GAGCTC 1 cut(s) 202
PspN4I GGNNCC 1 cut(s) 257
PspPI GGNCC 1 cut(s) 255
PsrI GAACNNNNNNTAC 2 cut(s) 583, 615
PsuI RGATCY 3 cut(s) 6, 351, 609
RsaI GTAC 4 cut(s) 323, 463, 584, 592
RsaNI GTAC 4 cut(s) 322, 462, 583, 591
SacI GAGCTC 1 cut(s) 202
Sau3AI GATC 7 cut(s) 6, 18, 63, 351, 450, 594, 609
Sau96I GGNCC 1 cut(s) 255
ScrFI CCNGG 1 cut(s) 483
SduI GDGCHC 1 cut(s) 202
SetI ASST 7 cut(s) 18, 51, 81, 202, 366, 407, 447
Sse9I AATT 7 cut(s) 84, 133, 282, 326, 333, 341, 436
SspMI CTAG 2 cut(s) 349, 541
SstI GAGCTC 1 cut(s) 202
StyD4I CCNGG 1 cut(s) 481
StyI CCWWGG 1 cut(s) 429
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 2 cut(s) 119, 219
TasI AATT 7 cut(s) 84, 133, 282, 326, 333, 341, 436
TatI WGTACW 1 cut(s) 461
TspDTI ATGAA 2 cut(s) 86, 142
TspGWI ACGGA 1 cut(s) 557
XapI RAATTY 4 cut(s) 133, 282, 341, 436
XmiI GTMKAC 1 cut(s) 398
XmnI GAANNNNTTC 1 cut(s) 133
XspI CTAG 2 cut(s) 349, 541
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.