Rmu_sc0004286.1_g000014

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004286.1
OG0000976
Physical Location & Seq
Reverse (-)
45135 .. 45974
840 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004286.1_g000014.1.cds

Sequence Viewer

Length: 840 bp
atgagtactacagtagcccctaagacaaagataacaaatatcccaggtcttactactggatttctcaccaatcagaagaaccattcccagcagatccataaagttacttggaacgaagtaacttttcctcctgaatggaaattatccggtccaaaaaagcaaccgaaaatagcaaaagcaaaaatctacgagagtagaagaactggagaaatcagcctcaactttgacaatcacagaaaaagtgatgtctgtcctgagaacctcaggataaacagcagtcttctgagaagaagttacagcactagagaagctagtgtcagtggtacaaaacccactattgaagagccaatatcagaagaagatctagaagctgatctaagcagaccagtccatatgctcagagctgagagggtctatgatctttatgaagaagctgagaattgtgaaagtcctgaacgattagaaaaattaatcgaagaaatgaaagaattcaaaatcagaaagacaagaaaagtctttccttatcaagatactgaaatggaagatggagaaagctccagaactttcattagcagagaaaaaagggaaacaaaactcccatttcagaaggcccccacgggtaaaaaaggggaaagaaattcccaaagatttgtcccagaggacaatctgcctagagtaccaatcacgaactatgacatatggttaaatctagacaagagtctagacaaaagaaaaaccattgaccaatgggtagacagcctgatgatggcttctgcacttacccttggcaaatttgaagcaccagatttgcaggtgtactatgaaactactcttacatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

279

Amino Acids

32.39

Weight (kDa)

8.33

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 802
Acc36I ACCTGC 1 cut(s) 802
AccI GTMKAC 1 cut(s) 753
AclWI GGATC 1 cut(s) 88
AcsI RAATTY 3 cut(s) 488, 637, 791
AfaI GTAC 4 cut(s) 7, 325, 678, 818
AfiI CCNNNNNNNGG 1 cut(s) 766
AgsI TTSAA 3 cut(s) 341, 493, 797
AjnI CCWGG 1 cut(s) 43
AluBI AGCT 5 cut(s) 311, 371, 404, 434, 555
AluI AGCT 5 cut(s) 311, 371, 404, 434, 555
AlwI GGATC 1 cut(s) 88
AoxI GGCC 1 cut(s) 609
ApoI RAATTY 3 cut(s) 488, 637, 791
AseI ATTAAT 1 cut(s) 470
Asp700I GAANNNNTTC 1 cut(s) 488
AspS9I GGNCC 2 cut(s) 149, 610
AsuHPI GGTGA 1 cut(s) 58
AvaII GGWCC 1 cut(s) 149
AxyI CCTNAGG 1 cut(s) 263
BbsI GAAGAC 1 cut(s) 272
BccI CCATC 2 cut(s) 539, 760
BciT130I CCWGG 1 cut(s) 45
BfaI CTAG 6 cut(s) 303, 312, 365, 672, 710, 722
BfmI CTRYAG 1 cut(s) 9
BfuAI ACCTGC 1 cut(s) 802
BglII AGATCT 1 cut(s) 361
BmcAI AGTACT 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 45
Bme18I GGWCC 1 cut(s) 149
BmgT120I GGNCC 2 cut(s) 149, 610
BmiI GGNNCC 1 cut(s) 612
BmrFI CCNGG 1 cut(s) 45
BoxI GACNNNNGTC 1 cut(s) 717
BpiI GAAGAC 1 cut(s) 272
BpmI CTGGAG 2 cut(s) 225, 541
BsaJI CCNNGG 3 cut(s) 43, 615, 784
BsaWI WCCGGW 1 cut(s) 146
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
Bsc4I CCNNNNNNNGG 1 cut(s) 766
Bse1I ACTGG 3 cut(s) 61, 208, 386
Bse21I CCTNAGG 1 cut(s) 263
BseBI CCWGG 1 cut(s) 45
BseDI CCNNGG 3 cut(s) 43, 615, 784
BseLI CCNNNNNNNGG 1 cut(s) 766
BseMII CTCAG 6 cut(s) 246, 275, 277, 396, 412, 426
BseNI ACTGG 3 cut(s) 61, 208, 386
BseYI CCCAGC 1 cut(s) 87
BsgI GTGCAG 1 cut(s) 759
BshFI GGCC 1 cut(s) 611
BsiSI CCGG 1 cut(s) 147
BslFI GGGAC 1 cut(s) 638
BslI CCNNNNNNNGG 1 cut(s) 766
BsmFI GGGAC 1 cut(s) 638
BsnI GGCC 1 cut(s) 611
Bsp143I GATC 4 cut(s) 93, 361, 373, 418
BspANI GGCC 1 cut(s) 611
BspCNI CTCAG 6 cut(s) 247, 276, 276, 397, 411, 427
BspLI GGNNCC 1 cut(s) 612
BspMI ACCTGC 1 cut(s) 802
BspPI GGATC 1 cut(s) 88
BspQI GCTCTTC 1 cut(s) 336
BsrI ACTGG 3 cut(s) 61, 208, 386
BssECI CCNNGG 3 cut(s) 43, 615, 784
BssMI GATC 4 cut(s) 93, 361, 373, 418
BssT1I CCWWGG 1 cut(s) 784
Bst2UI CCWGG 1 cut(s) 45
Bst4CI ACNGT 1 cut(s) 13
Bst6I CTCTTC 1 cut(s) 336
BstDEI CTNAG 8 cut(s) 21, 255, 263, 284, 377, 398, 405, 435
BstDSI CCRYGG 1 cut(s) 615
BstKTI GATC 4 cut(s) 96, 364, 376, 421
BstMBI GATC 4 cut(s) 93, 361, 373, 418
BstNI CCWGG 1 cut(s) 45
BstPAI GACNNNNGTC 1 cut(s) 717
BstSCI CCNGG 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 9
BstV2I GAAGAC 1 cut(s) 272
BstX2I RGATCY 2 cut(s) 93, 361
BstYI RGATCY 2 cut(s) 93, 361
Bsu36I CCTNAGG 1 cut(s) 263
BsuRI GGCC 1 cut(s) 611
BtgI CCRYGG 1 cut(s) 615
BtsIMutI CAGTG 1 cut(s) 325
BveI ACCTGC 1 cut(s) 802
Cfr13I GGNCC 2 cut(s) 149, 610
Csp6I GTAC 4 cut(s) 6, 324, 677, 817
CviAII CATG 1 cut(s) 837
CviQI GTAC 4 cut(s) 6, 324, 677, 817
DdeI CTNAG 8 cut(s) 21, 255, 263, 284, 377, 398, 405, 435
DpnI GATC 4 cut(s) 95, 363, 375, 420
DpnII GATC 4 cut(s) 93, 361, 373, 418
Eam1104I CTCTTC 1 cut(s) 336
EarI CTCTTC 1 cut(s) 336
Eco130I CCWWGG 1 cut(s) 784
Eco47I GGWCC 1 cut(s) 149
Eco81I CCTNAGG 1 cut(s) 263
EcoO109I RGGNCCY 1 cut(s) 610
EcoRI GAATTC 1 cut(s) 488
EcoRII CCWGG 1 cut(s) 43
EcoT14I CCWWGG 1 cut(s) 784
ErhI CCWWGG 1 cut(s) 784
FaeI CATG 1 cut(s) 840
FaqI GGGAC 1 cut(s) 638
FatI CATG 1 cut(s) 836
FauNDI CATATG 2 cut(s) 393, 698
FblI GTMKAC 1 cut(s) 753
FspBI CTAG 6 cut(s) 303, 312, 365, 672, 710, 722
GsaI CCCAGC 1 cut(s) 91
GsuI CTGGAG 2 cut(s) 225, 541
HaeIII GGCC 1 cut(s) 611
HapII CCGG 1 cut(s) 147
Hin1II CATG 1 cut(s) 840
HinfI GANTC 1 cut(s) 718
HpaII CCGG 1 cut(s) 147
HphI GGTGA 1 cut(s) 58
Hpy166II GTNNAC 2 cut(s) 754, 817
Hpy188I TCNGA 6 cut(s) 75, 285, 355, 401, 500, 606
Hpy8I GTNNAC 2 cut(s) 754, 817
HpyAV CCTTC 1 cut(s) 601
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4V TGCA 2 cut(s) 776, 811
HpyF3I CTNAG 8 cut(s) 21, 255, 263, 284, 377, 398, 405, 435
Hsp92II CATG 1 cut(s) 840
Kzo9I GATC 4 cut(s) 93, 361, 373, 418
LguI GCTCTTC 1 cut(s) 336
LmnI GCTCC 1 cut(s) 560
MaeI CTAG 6 cut(s) 303, 312, 365, 672, 710, 722
MaeIII GTNAC 3 cut(s) 103, 118, 293
MalI GATC 4 cut(s) 95, 363, 375, 420
MboI GATC 4 cut(s) 93, 361, 373, 418
MflI RGATCY 2 cut(s) 93, 361
MluCI AATT 6 cut(s) 140, 439, 467, 488, 637, 791
MlyI GAGTC 1 cut(s) 727
MnlI CCTC 5 cut(s) 138, 227, 272, 402, 652
MroXI GAANNNNTTC 1 cut(s) 488
MseI TTAA 2 cut(s) 470, 704
MspI CCGG 1 cut(s) 147
MspR9I CCNGG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 45
NdeI CATATG 2 cut(s) 393, 698
NdeII GATC 4 cut(s) 93, 361, 373, 418
NlaIII CATG 1 cut(s) 840
NlaIV GGNNCC 1 cut(s) 612
PaqCI CACCTGC 1 cut(s) 802
PciSI GCTCTTC 1 cut(s) 336
PdmI GAANNNNTTC 1 cut(s) 488
PleI GAGTC 1 cut(s) 726
PpsI GAGTC 1 cut(s) 726
PshAI GACNNNNGTC 1 cut(s) 717
PshBI ATTAAT 1 cut(s) 470
Psp6I CCWGG 1 cut(s) 43
PspFI CCCAGC 1 cut(s) 87
PspGI CCWGG 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 612
PspPI GGNCC 2 cut(s) 149, 610
PsuI RGATCY 2 cut(s) 93, 361
RsaI GTAC 4 cut(s) 7, 325, 678, 818
RsaNI GTAC 4 cut(s) 6, 324, 677, 817
SapI GCTCTTC 1 cut(s) 336
SaqAI TTAA 2 cut(s) 470, 704
Sau3AI GATC 4 cut(s) 93, 361, 373, 418
Sau96I GGNCC 2 cut(s) 149, 610
ScaI AGTACT 1 cut(s) 7
SchI GAGTC 1 cut(s) 727
ScrFI CCNGG 1 cut(s) 45
SetI ASST 8 cut(s) 49, 264, 313, 373, 406, 436, 557, 816
SfcI CTRYAG 1 cut(s) 9
SinI GGWCC 1 cut(s) 149
Sse9I AATT 6 cut(s) 140, 439, 467, 488, 637, 791
SspMI CTAG 6 cut(s) 303, 312, 365, 672, 710, 722
StyD4I CCNGG 1 cut(s) 43
StyI CCWWGG 1 cut(s) 784
TaaI ACNGT 1 cut(s) 13
TaqI TCGA 1 cut(s) 474
TasI AATT 6 cut(s) 140, 439, 467, 488, 637, 791
TatI WGTACW 2 cut(s) 5, 816
Tru1I TTAA 2 cut(s) 470, 704
Tru9I TTAA 2 cut(s) 470, 704
TscAI CASTG 1 cut(s) 325
TspDTI ATGAA 4 cut(s) 441, 497, 556, 837
TspRI CASTG 1 cut(s) 325
VpaK11BI GGWCC 1 cut(s) 149
VspI ATTAAT 1 cut(s) 470
XapI RAATTY 3 cut(s) 488, 637, 791
XbaI TCTAGA 3 cut(s) 364, 709, 721
XmiI GTMKAC 1 cut(s) 753
XmnI GAANNNNTTC 1 cut(s) 488
XspI CTAG 6 cut(s) 303, 312, 365, 672, 710, 722
ZrmI AGTACT 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.