Rmu_sc0001018.1_g000020

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001018.1
OG0000976
Physical Location & Seq
Forward (+)
84922 .. 85776
855 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001018.1_g000020.1.cds

Sequence Viewer

Length: 855 bp
atgccaaagcggcaatttatgaaagcagatcgaaagactggagatatcagtctaaaattcgacgatcacagaaaaagtgacgtctgtccagaaaatgtcaggataaacaacaatattcttaaaagaacctacaacactagagaagctagtgttagtggtactaaatactttgaagaaccatcagagtccatcactgaagaagatttagaagctgatctgaacagactagtaaatatgcttagagcacaaaagctctatgatgaaacagagtcctgcgaaaatcctgaacgattagaaatgctaatcgaagaaatgaaaattttcaaaccaggaaaggaaagaaatctcattccctatcaggatattgaaatggaagaaggagaaagctccaaaactttcataaccagagaaaaaggaaaagtgaaatttccaacccttgaagcatctttatgcaatcaagtgacatatttcaactgcttcccaaatttctcaaccagcttgaaagatgcagctcactgtctaagactgagagtcaagacagatggcatatctatgaaaaatgatatgcaagatctagctatagtatacagaatatactataaattgatgagtaccacagtagaacctaaaacaatgatatcaaatatcccaggtcttactactggtttcctcaccagccagaaaaaccattcacaacagattcacaaggttacttggaatgaagtaacttttcctcttgaatggaaattgtctgatccaaaaaaaccaatagaaaatgccaaagcggcaatttatgaaagcagatcgaaagactggagatatcagtctaaaattcgacgatcacagaaaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

284

Amino Acids

33.24

Weight (kDa)

8.88

Isoelectric Point (pI)

47.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 84
AccI GTMKAC 1 cut(s) 585
AciI CCGC 2 cut(s) 10, 785
AclWI GGATC 1 cut(s) 749
AcsI RAATTY 5 cut(s) 56, 318, 425, 484, 831
AcuI CTGAAG 1 cut(s) 216
AcyI GRCGYC 1 cut(s) 81
AfaI GTAC 2 cut(s) 160, 613
AgsI TTSAA 7 cut(s) 173, 325, 368, 440, 472, 502, 740
AhdI GACNNNNNGTC 1 cut(s) 530
AhlI ACTAGT 1 cut(s) 226
AjnI CCWGG 2 cut(s) 328, 649
AluBI AGCT 7 cut(s) 146, 212, 253, 387, 498, 512, 578
AluI AGCT 7 cut(s) 146, 212, 253, 387, 498, 512, 578
Alw21I GWGCWC 1 cut(s) 247
AlwI GGATC 1 cut(s) 749
ApeKI GCWGC 1 cut(s) 509
ApoI RAATTY 5 cut(s) 56, 318, 425, 484, 831
Asp700I GAANNNNTTC 1 cut(s) 320
AsuHPI GGTGA 1 cut(s) 664
Bbv12I GWGCWC 1 cut(s) 247
BbvI GCAGC 1 cut(s) 521
BccI CCATC 3 cut(s) 187, 197, 536
BciT130I CCWGG 2 cut(s) 330, 651
BcuI ACTAGT 1 cut(s) 226
BfaI CTAG 4 cut(s) 138, 147, 227, 575
BfmI CTRYAG 1 cut(s) 579
BglI GCCNNNNNGGC 2 cut(s) 10, 785
BglII AGATCT 1 cut(s) 571
BisI GCNGC 3 cut(s) 11, 510, 786
BlsI GCNGC 3 cut(s) 12, 511, 787
Bme1390I CCNGG 2 cut(s) 330, 651
BmeRI GACNNNNNGTC 1 cut(s) 530
BmrFI CCNGG 2 cut(s) 330, 651
BmsI GCATC 2 cut(s) 452, 496
BoxI GACNNNNGTC 1 cut(s) 84
BpmI CTGGAG 2 cut(s) 60, 835
BsaHI GRCGYC 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 649
Bse1I ACTGG 3 cut(s) 43, 667, 818
BseBI CCWGG 2 cut(s) 330, 651
BseDI CCNNGG 1 cut(s) 649
BseMII CTCAG 1 cut(s) 518
BseNI ACTGG 3 cut(s) 43, 667, 818
BseXI GCAGC 1 cut(s) 521
BsiHKAI GWGCWC 1 cut(s) 247
Bsp1286I GDGCHC 1 cut(s) 247
Bsp143I GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
BspACI CCGC 2 cut(s) 10, 785
BspCNI CTCAG 1 cut(s) 519
BspPI GGATC 1 cut(s) 749
BsrI ACTGG 3 cut(s) 43, 667, 818
BssECI CCNNGG 1 cut(s) 649
BssMI GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
BssNAI GTATAC 1 cut(s) 586
BssNI GRCGYC 1 cut(s) 81
Bst1107I GTATAC 1 cut(s) 586
Bst2UI CCWGG 2 cut(s) 330, 651
Bst4CI ACNGT 2 cut(s) 518, 619
BstACI GRCGYC 1 cut(s) 81
BstDEI CTNAG 3 cut(s) 239, 521, 527
BstKTI GATC 7 cut(s) 31, 67, 217, 574, 757, 806, 842
BstMBI GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
BstMWI GCNNNNNNNGC 2 cut(s) 10, 785
BstNI CCWGG 2 cut(s) 330, 651
BstPAI GACNNNNGTC 1 cut(s) 84
BstSCI CCNGG 2 cut(s) 328, 649
BstSFI CTRYAG 1 cut(s) 579
BstV1I GCAGC 1 cut(s) 521
BstX2I RGATCY 1 cut(s) 571
BstYI RGATCY 1 cut(s) 571
BstZ17I GTATAC 1 cut(s) 586
BtsIMutI CAGTG 2 cut(s) 192, 514
Csp6I GTAC 2 cut(s) 159, 612
CviJI RGCY 8 cut(s) 146, 212, 253, 387, 498, 512, 578, 678
CviKI_1 RGCY 8 cut(s) 146, 212, 253, 387, 498, 512, 578, 678
CviQI GTAC 2 cut(s) 159, 612
DdeI CTNAG 3 cut(s) 239, 521, 527
DpnI GATC 7 cut(s) 30, 66, 216, 573, 756, 805, 841
DpnII GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
DriI GACNNNNNGTC 1 cut(s) 530
Eam1105I GACNNNNNGTC 1 cut(s) 530
Eco32I GATATC 3 cut(s) 46, 639, 821
Eco57I CTGAAG 1 cut(s) 216
EcoRII CCWGG 2 cut(s) 328, 649
EcoRV GATATC 3 cut(s) 46, 639, 821
FblI GTMKAC 1 cut(s) 585
Fnu4HI GCNGC 3 cut(s) 11, 510, 786
Fsp4HI GCNGC 3 cut(s) 11, 510, 786
FspBI CTAG 4 cut(s) 138, 147, 227, 575
GluI GCNGC 3 cut(s) 11, 510, 786
GsuI CTGGAG 2 cut(s) 60, 835
Hin1I GRCGYC 1 cut(s) 81
HinfI GANTC 4 cut(s) 185, 269, 531, 700
HphI GGTGA 1 cut(s) 664
Hpy166II GTNNAC 1 cut(s) 586
Hpy188I TCNGA 3 cut(s) 184, 219, 754
Hpy188III TCNNGA 6 cut(s) 89, 100, 284, 359, 535, 737
Hpy8I GTNNAC 1 cut(s) 586
Hpy99I CGWCG 2 cut(s) 65, 840
HpyAV CCTTC 1 cut(s) 371
HpyCH4III ACNGT 2 cut(s) 518, 619
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 3 cut(s) 453, 509, 568
HpyF10VI GCNNNNNNNGC 2 cut(s) 10, 785
HpyF3I CTNAG 3 cut(s) 239, 521, 527
HpySE526I ACGT 1 cut(s) 81
Hsp92I GRCGYC 1 cut(s) 81
Kzo9I GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
LmnI GCTCC 1 cut(s) 392
Lsp1109I GCAGC 1 cut(s) 521
LweI GCATC 2 cut(s) 452, 496
MaeI CTAG 4 cut(s) 138, 147, 227, 575
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 4 cut(s) 77, 460, 709, 724
MalI GATC 7 cut(s) 30, 66, 216, 573, 756, 805, 841
MboI GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
MboII GAAGA 5 cut(s) 185, 209, 212, 320, 386
MflI RGATCY 1 cut(s) 571
MhlI GDGCHC 1 cut(s) 247
MluCI AATT 9 cut(s) 14, 56, 318, 425, 484, 602, 746, 789, 831
MlyI GAGTC 3 cut(s) 194, 278, 540
MmeI TCCRAC 1 cut(s) 455
MnlI CCTC 2 cut(s) 680, 744
MroXI GAANNNNTTC 1 cut(s) 320
MseI TTAA 1 cut(s) 120
MslI CAYNNNNRTG 2 cut(s) 448, 551
MspR9I CCNGG 2 cut(s) 330, 651
MvaI CCWGG 2 cut(s) 330, 651
MwoI GCNNNNNNNGC 2 cut(s) 10, 785
NdeII GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
NmuCI GTSAC 2 cut(s) 77, 460
PdmI GAANNNNTTC 1 cut(s) 320
PfeI GAWTC 1 cut(s) 700
PkrI GCNGC 3 cut(s) 12, 511, 787
PleI GAGTC 3 cut(s) 193, 277, 539
PpsI GAGTC 3 cut(s) 193, 277, 539
PshAI GACNNNNGTC 1 cut(s) 84
Psp6I CCWGG 2 cut(s) 328, 649
PspGI CCWGG 2 cut(s) 328, 649
PsuI RGATCY 1 cut(s) 571
RsaI GTAC 2 cut(s) 160, 613
RsaNI GTAC 2 cut(s) 159, 612
RseI CAYNNNNRTG 2 cut(s) 448, 551
SaqAI TTAA 1 cut(s) 120
SatI GCNGC 3 cut(s) 11, 510, 786
Sau3AI GATC 7 cut(s) 28, 64, 214, 571, 754, 803, 839
SchI GAGTC 3 cut(s) 194, 278, 540
ScrFI CCNGG 2 cut(s) 330, 651
SduI GDGCHC 1 cut(s) 247
SfaNI GCATC 2 cut(s) 452, 496
SfcI CTRYAG 1 cut(s) 579
SmiMI CAYNNNNRTG 2 cut(s) 448, 551
SpeI ACTAGT 1 cut(s) 226
Sse9I AATT 9 cut(s) 14, 56, 318, 425, 484, 602, 746, 789, 831
SsiI CCGC 2 cut(s) 10, 785
SspI AATATT 1 cut(s) 115
SspMI CTAG 4 cut(s) 138, 147, 227, 575
StyD4I CCNGG 2 cut(s) 328, 649
TaaI ACNGT 2 cut(s) 518, 619
TaiI ACGT 1 cut(s) 84
TaqI TCGA 5 cut(s) 31, 60, 306, 806, 835
TasI AATT 9 cut(s) 14, 56, 318, 425, 484, 602, 746, 789, 831
TauI GCSGC 2 cut(s) 13, 788
TfiI GAWTC 1 cut(s) 700
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TscAI CASTG 2 cut(s) 199, 521
TseFI GTSAC 2 cut(s) 77, 460
TseI GCWGC 1 cut(s) 509
Tsp45I GTSAC 2 cut(s) 77, 460
TspDTI ATGAA 7 cut(s) 35, 276, 329, 388, 569, 735, 810
TspRI CASTG 2 cut(s) 199, 521
XapI RAATTY 5 cut(s) 56, 318, 425, 484, 831
XmiI GTMKAC 1 cut(s) 585
XmnI GAANNNNTTC 1 cut(s) 320
XspI CTAG 4 cut(s) 138, 147, 227, 575
ZraI GACGTC 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.