Rmu_ssc0000052.1_g000014

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000052.1
OG0000976
Physical Location & Seq
Reverse (-)
38055 .. 38510
456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000052.1_g000014.1.cds

Sequence Viewer

Length: 456 bp
atggaagaattagaaagctctaaaacttccatcattagagaaaagggaaagcttaaactccctgtacagaaggcccctacgggcagaaatggtgaaagaaattttcaaagatttttcccagaggacaagatgcccagagtaccaatttccaactatggaatttggctagatctggacaaagctctagacaagagaaaaacttttgaccaatgggtagatagcctgatgatggcctctgctcttacccttggaaaatttgaagctcctgatcttcagatgtactttgaaactactctcaccggagtagcaaagaagtattatttttctttcaaagaaactgctagaggaaaagaatggctggaagaaatcaaaacttcaaaatctccgtatgattttgcagtacccatgtacgatcagttctgtgaagatctctcaaatttgagtcaaaaaggctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

151

Amino Acids

17.56

Weight (kDa)

7.72

Isoelectric Point (pI)

40.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 100, 159, 254, 436
AcuI CTGAAG 1 cut(s) 257
AfaI GTAC 5 cut(s) 66, 141, 281, 402, 410
AfiI CCNNNNNNNGG 1 cut(s) 229
AgsI TTSAA 5 cut(s) 107, 260, 287, 331, 378
AluBI AGCT 4 cut(s) 18, 52, 182, 263
AluI AGCT 4 cut(s) 18, 52, 182, 263
AoxI GGCC 2 cut(s) 72, 231
ApoI RAATTY 4 cut(s) 100, 159, 254, 436
AspS9I GGNCC 1 cut(s) 73
AsuHPI GGTGA 2 cut(s) 104, 289
BccI CCATC 2 cut(s) 38, 223
BfaI CTAG 3 cut(s) 167, 185, 342
BglII AGATCT 2 cut(s) 169, 427
BmgT120I GGNCC 1 cut(s) 73
BmiI GGNNCC 1 cut(s) 75
BmsI GCATC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 247
BsaWI WCCGGW 1 cut(s) 299
Bsc4I CCNNNNNNNGG 1 cut(s) 229
BseDI CCNNGG 1 cut(s) 247
BseLI CCNNNNNNNGG 1 cut(s) 229
BshFI GGCC 2 cut(s) 74, 233
BsiSI CCGG 1 cut(s) 300
BslI CCNNNNNNNGG 1 cut(s) 229
BsnI GGCC 2 cut(s) 74, 233
Bsp1407I TGTACA 1 cut(s) 64
Bsp143I GATC 4 cut(s) 169, 268, 412, 427
BspANI GGCC 2 cut(s) 74, 233
BspLI GGNNCC 1 cut(s) 75
BsrGI TGTACA 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 247
BssMI GATC 4 cut(s) 169, 268, 412, 427
BssT1I CCWWGG 1 cut(s) 247
BstAUI TGTACA 1 cut(s) 64
BstKTI GATC 4 cut(s) 172, 271, 415, 430
BstMBI GATC 4 cut(s) 169, 268, 412, 427
BstX2I RGATCY 2 cut(s) 169, 427
BstYI RGATCY 2 cut(s) 169, 427
BsuRI GGCC 2 cut(s) 74, 233
Cfr13I GGNCC 1 cut(s) 73
Csp6I GTAC 5 cut(s) 65, 140, 280, 401, 409
CviAII CATG 1 cut(s) 406
CviQI GTAC 5 cut(s) 65, 140, 280, 401, 409
DpnI GATC 4 cut(s) 171, 270, 414, 429
DpnII GATC 4 cut(s) 169, 268, 412, 427
Eco130I CCWWGG 1 cut(s) 247
Eco57I CTGAAG 1 cut(s) 257
EcoO109I RGGNCCY 1 cut(s) 73
EcoT14I CCWWGG 1 cut(s) 247
ErhI CCWWGG 1 cut(s) 247
FaeI CATG 1 cut(s) 409
FaiI YATR 3 cut(s) 156, 390, 407
FatI CATG 1 cut(s) 405
FspBI CTAG 3 cut(s) 167, 185, 342
HaeIII GGCC 2 cut(s) 74, 233
HapII CCGG 1 cut(s) 300
Hin1II CATG 1 cut(s) 409
HindIII AAGCTT 1 cut(s) 50
HinfI GANTC 1 cut(s) 442
HpaII CCGG 1 cut(s) 300
HphI GGTGA 2 cut(s) 104, 289
Hpy188I TCNGA 1 cut(s) 276
Hpy188III TCNNGA 3 cut(s) 173, 185, 266
HpyAV CCTTC 1 cut(s) 64
HpyCH4V TGCA 1 cut(s) 398
Hsp92II CATG 1 cut(s) 409
Kzo9I GATC 4 cut(s) 169, 268, 412, 427
LmnI GCTCC 1 cut(s) 268
LpnPI CCDG 8 cut(s) 75, 132, 148, 158, 236, 279, 313, 344
LweI GCATC 1 cut(s) 120
MaeI CTAG 3 cut(s) 167, 185, 342
MalI GATC 4 cut(s) 171, 270, 414, 429
MboI GATC 4 cut(s) 169, 268, 412, 427
MboII GAAGA 4 cut(s) 17, 263, 374, 437
MflI RGATCY 2 cut(s) 169, 427
MluCI AATT 6 cut(s) 8, 100, 144, 159, 254, 436
MlyI GAGTC 1 cut(s) 451
MmeI TCCRAC 1 cut(s) 174
MnlI CCTC 3 cut(s) 115, 244, 338
MseI TTAA 1 cut(s) 54
MspI CCGG 1 cut(s) 300
NdeII GATC 4 cut(s) 169, 268, 412, 427
NlaIII CATG 1 cut(s) 409
NlaIV GGNNCC 1 cut(s) 75
PleI GAGTC 1 cut(s) 450
PpsI GAGTC 1 cut(s) 450
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 73
PsrI GAACNNNNNNTAC 2 cut(s) 401, 433
PsuI RGATCY 2 cut(s) 169, 427
RsaI GTAC 5 cut(s) 66, 141, 281, 402, 410
RsaNI GTAC 5 cut(s) 65, 140, 280, 401, 409
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 4 cut(s) 169, 268, 412, 427
Sau96I GGNCC 1 cut(s) 73
SchI GAGTC 1 cut(s) 451
SetI ASST 4 cut(s) 20, 54, 184, 265
SfaNI GCATC 1 cut(s) 120
Sse9I AATT 6 cut(s) 8, 100, 144, 159, 254, 436
SspMI CTAG 3 cut(s) 167, 185, 342
StyI CCWWGG 1 cut(s) 247
TasI AATT 6 cut(s) 8, 100, 144, 159, 254, 436
TatI WGTACW 2 cut(s) 64, 279
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TspGWI ACGGA 1 cut(s) 375
XapI RAATTY 4 cut(s) 100, 159, 254, 436
XbaI TCTAGA 1 cut(s) 184
XspI CTAG 3 cut(s) 167, 185, 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.