Rmu_sc0003467.1_g000010

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003467.1
OG0000976
Physical Location & Seq
Reverse (-)
26370 .. 27959
1590 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003467.1_g000010.1.cds

Sequence Viewer

Length: 882 bp
atgcctgcagtaaaaacaaagaaagctaatggatttaaaccattagaaagaccagataagaatcctgttccaaacatgatttttctggaaccatctactagtattagtgacttttccattgaatggaaattatctggtccgaaaaaaccaccagagagtgccaaggcaaaagtctatgaaagcagaaagactggagaaatcagtctcaattttgacaatcacagaaaaagtgatgtctgtcctgagaacatcaggatcaacaaaaatcttctcagaagaagctatagcactagagaagctagtgttagtggtaccaaacccactattgaagaaccaatatctgaagaagaactagaaactgatctaaacagaccagttaatatgcttagagcacaaaagctttatgacctctatgatgaagcagaatcttgtgaaaatcctgaacgattagagaaactaatagaagaaatgaaaaatatcaaaccaggaaaggaaagaaaactccttccctatcaagatattgaaatggaagaaggagaaagctccaaaaccttcatcagtagagaaaaagggaaactgaagctccctatacaaaaagccccgacggggaaaaatggagaaagaaattctcaaagatttgtctcagaagacaatatacccagagtaccaatttccactcatgatatctggctaaatctagacaaagctctagacaagagaaaaactcttgaccaatgggttgatagcctgatgatggcttctgctctaacccttggaaaatttgaagtaccagatctgcaggtgtactatgaaactactctcaccggagtagcaaaaaagtattacttctcttttaaagagattgccagaggaaaacactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2 PPR_3

Protein Analysis

293

Amino Acids

33.68

Weight (kDa)

8.75

Isoelectric Point (pI)

48.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 790
Acc36I ACCTGC 1 cut(s) 790
Acc65I GGTACC 1 cut(s) 311
AccB1I GGYRCC 1 cut(s) 311
AccB7I CCANNNNNTGG 1 cut(s) 123
AclWI GGATC 1 cut(s) 263
AcsI RAATTY 2 cut(s) 625, 779
AcuI CTGAAG 2 cut(s) 363, 599
AfaI GTAC 4 cut(s) 313, 666, 789, 806
AfiI CCNNNNNNNGG 3 cut(s) 123, 606, 754
AgsI TTSAA 4 cut(s) 122, 329, 524, 785
AhlI ACTAGT 1 cut(s) 98
AjnI CCWGG 1 cut(s) 484
AluBI AGCT 7 cut(s) 26, 282, 299, 400, 543, 583, 707
AluI AGCT 7 cut(s) 26, 282, 299, 400, 543, 583, 707
Alw21I GWGCWC 1 cut(s) 394
Alw26I GTCTC 2 cut(s) 209, 646
AlwI GGATC 1 cut(s) 263
ApoI RAATTY 2 cut(s) 625, 779
Asp718I GGTACC 1 cut(s) 311
AspS9I GGNCC 1 cut(s) 137
AsuHPI GGTGA 1 cut(s) 814
AvaII GGWCC 1 cut(s) 137
BanI GGYRCC 1 cut(s) 311
BarI GAAGNNNNNNTAC 2 cut(s) 639, 671
BbsI GAAGAC 1 cut(s) 654
Bbv12I GWGCWC 1 cut(s) 394
BccI CCATC 2 cut(s) 100, 748
BciT130I CCWGG 1 cut(s) 486
BcoDI GTCTC 2 cut(s) 209, 646
BcuI ACTAGT 1 cut(s) 98
BfaI CTAG 7 cut(s) 99, 291, 300, 353, 698, 710, 880
BfmI CTRYAG 3 cut(s) 6, 283, 797
BfuAI ACCTGC 1 cut(s) 790
BglII AGATCT 1 cut(s) 793
Bme1390I CCNGG 1 cut(s) 486
Bme18I GGWCC 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 137
BmiI GGNNCC 2 cut(s) 90, 313
BmrFI CCNGG 1 cut(s) 486
BpiI GAAGAC 1 cut(s) 654
BplI GAGNNNNNCTC 2 cut(s) 709, 741
BpmI CTGGAG 1 cut(s) 213
BsaBI GATNNNNATC 1 cut(s) 60
BsaJI CCNNGG 2 cut(s) 162, 772
BsaWI WCCGGW 1 cut(s) 824
BsaXI ACNNNNNCTCC 2 cut(s) 567, 597
Bsc4I CCNNNNNNNGG 3 cut(s) 123, 606, 754
Bse1I ACTGG 2 cut(s) 196, 374
Bse8I GATNNNNATC 1 cut(s) 60
BseBI CCWGG 1 cut(s) 486
BseDI CCNNGG 2 cut(s) 162, 772
BseJI GATNNNNATC 1 cut(s) 60
BseLI CCNNNNNNNGG 3 cut(s) 123, 606, 754
BseMII CTCAG 3 cut(s) 234, 286, 657
BseNI ACTGG 2 cut(s) 196, 374
BshNI GGYRCC 1 cut(s) 311
BsiHKAI GWGCWC 1 cut(s) 394
BsiSI CCGG 1 cut(s) 825
BslI CCNNNNNNNGG 3 cut(s) 123, 606, 754
BsmAI GTCTC 2 cut(s) 209, 646
Bsp1286I GDGCHC 1 cut(s) 394
Bsp143I GATC 3 cut(s) 255, 361, 793
BspCNI CTCAG 3 cut(s) 235, 285, 656
BspHI TCATGA 1 cut(s) 679
BspLI GGNNCC 2 cut(s) 90, 313
BspMAI CTGCAG 2 cut(s) 10, 801
BspMI ACCTGC 1 cut(s) 790
BspPI GGATC 1 cut(s) 263
BspT107I GGYRCC 1 cut(s) 311
BsrI ACTGG 2 cut(s) 196, 374
BssECI CCNNGG 2 cut(s) 162, 772
BssMI GATC 3 cut(s) 255, 361, 793
BssT1I CCWWGG 2 cut(s) 162, 772
Bst2UI CCWGG 1 cut(s) 486
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 4 cut(s) 243, 272, 386, 643
BstKTI GATC 3 cut(s) 258, 364, 796
BstMAI GTCTC 2 cut(s) 209, 646
BstMBI GATC 3 cut(s) 255, 361, 793
BstNI CCWGG 1 cut(s) 486
BstSCI CCNGG 1 cut(s) 484
BstSFI CTRYAG 3 cut(s) 6, 283, 797
BstV2I GAAGAC 1 cut(s) 654
BstX2I RGATCY 1 cut(s) 793
BstYI RGATCY 1 cut(s) 793
BveI ACCTGC 1 cut(s) 790
Cac8I GCNNGC 1 cut(s) 6
CciI TCATGA 1 cut(s) 679
Cfr13I GGNCC 1 cut(s) 137
Csp6I GTAC 4 cut(s) 312, 665, 788, 805
CviAII CATG 2 cut(s) 76, 680
CviQI GTAC 4 cut(s) 312, 665, 788, 805
DdeI CTNAG 4 cut(s) 243, 272, 386, 643
DpnI GATC 3 cut(s) 257, 363, 795
DpnII GATC 3 cut(s) 255, 361, 793
DraI TTTAAA 2 cut(s) 37, 856
Eco130I CCWWGG 2 cut(s) 162, 772
Eco32I GATATC 1 cut(s) 685
Eco47I GGWCC 1 cut(s) 137
Eco57I CTGAAG 2 cut(s) 363, 599
EcoRII CCWGG 1 cut(s) 484
EcoRV GATATC 1 cut(s) 685
EcoT14I CCWWGG 2 cut(s) 162, 772
ErhI CCWWGG 2 cut(s) 162, 772
FaeI CATG 2 cut(s) 79, 683
FalI AAGNNNNNCTT 2 cut(s) 830, 862
FatI CATG 2 cut(s) 75, 679
FspBI CTAG 7 cut(s) 99, 291, 300, 353, 698, 710, 880
GsuI CTGGAG 1 cut(s) 213
HapII CCGG 1 cut(s) 825
Hin1II CATG 2 cut(s) 79, 683
HindIII AAGCTT 1 cut(s) 398
HinfI GANTC 2 cut(s) 61, 425
HpaII CCGG 1 cut(s) 825
HphI GGTGA 1 cut(s) 814
Hpy166II GTNNAC 1 cut(s) 805
Hpy188I TCNGA 4 cut(s) 141, 275, 343, 646
Hpy188III TCNNGA 9 cut(s) 86, 242, 253, 440, 515, 680, 698, 710, 728
Hpy8I GTNNAC 1 cut(s) 805
Hpy99I CGWCG 1 cut(s) 607
HpyAV CCTTC 3 cut(s) 515, 527, 562
HpyCH4V TGCA 2 cut(s) 8, 799
HpyF3I CTNAG 4 cut(s) 243, 272, 386, 643
Hsp92II CATG 2 cut(s) 79, 683
KpnI GGTACC 1 cut(s) 315
Kzo9I GATC 3 cut(s) 255, 361, 793
LmnI GCTCC 2 cut(s) 548, 588
MaeI CTAG 7 cut(s) 99, 291, 300, 353, 698, 710, 880
MaeIII GTNAC 1 cut(s) 107
MalI GATC 3 cut(s) 257, 363, 795
MboI GATC 3 cut(s) 255, 361, 793
MboII GAAGA 8 cut(s) 260, 288, 341, 356, 359, 476, 542, 659
MflI RGATCY 1 cut(s) 793
MhlI GDGCHC 1 cut(s) 394
MluCI AATT 5 cut(s) 128, 208, 625, 669, 779
MnlI CCTC 2 cut(s) 419, 863
MseI TTAA 3 cut(s) 36, 378, 855
MspI CCGG 1 cut(s) 825
MspR9I CCNGG 1 cut(s) 486
MvaI CCWGG 1 cut(s) 486
NdeII GATC 3 cut(s) 255, 361, 793
NlaIII CATG 2 cut(s) 79, 683
NlaIV GGNNCC 2 cut(s) 90, 313
NmuCI GTSAC 1 cut(s) 107
PagI TCATGA 1 cut(s) 679
PaqCI CACCTGC 1 cut(s) 790
PfeI GAWTC 2 cut(s) 61, 425
PflMI CCANNNNNTGG 1 cut(s) 123
Psp6I CCWGG 1 cut(s) 484
PspGI CCWGG 1 cut(s) 484
PspN4I GGNNCC 2 cut(s) 90, 313
PspPI GGNCC 1 cut(s) 137
PstI CTGCAG 2 cut(s) 10, 801
PsuI RGATCY 1 cut(s) 793
RsaI GTAC 4 cut(s) 313, 666, 789, 806
RsaNI GTAC 4 cut(s) 312, 665, 788, 805
SaqAI TTAA 3 cut(s) 36, 378, 855
Sau3AI GATC 3 cut(s) 255, 361, 793
Sau96I GGNCC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 486
SduI GDGCHC 1 cut(s) 394
SfcI CTRYAG 3 cut(s) 6, 283, 797
SinI GGWCC 1 cut(s) 137
SpeI ACTAGT 1 cut(s) 98
Sse9I AATT 5 cut(s) 128, 208, 625, 669, 779
SspMI CTAG 7 cut(s) 99, 291, 300, 353, 698, 710, 880
StyD4I CCNGG 1 cut(s) 484
StyI CCWWGG 2 cut(s) 162, 772
TasI AATT 5 cut(s) 128, 208, 625, 669, 779
TatI WGTACW 1 cut(s) 804
TfiI GAWTC 2 cut(s) 61, 425
Tru1I TTAA 3 cut(s) 36, 378, 855
Tru9I TTAA 3 cut(s) 36, 378, 855
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 5 cut(s) 192, 432, 485, 544, 825
Van91I CCANNNNNTGG 1 cut(s) 123
VpaK11BI GGWCC 1 cut(s) 137
XapI RAATTY 2 cut(s) 625, 779
XbaI TCTAGA 2 cut(s) 697, 709
XspI CTAG 7 cut(s) 99, 291, 300, 353, 698, 710, 880
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.