Rmu_sc0008681.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008681.1
OG0000976
Physical Location & Seq
Reverse (-)
5689 .. 6225
537 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008681.1_g000002.1.cds

Sequence Viewer

Length: 537 bp
atgcttaaagcacaaaagctctatgatctctatgatgaagcagaatcctgcaacaatcctgaacgattagaaaaactaatcgaagaaatgaaaattttcaaaccaggaaaggaaagaaaactccttccctaccaggatattgaaatggaagaaggagaaagcaccaaaactttcatcaccagagaaaagggaaaagtaaaactccctttacagaaagcccctacgggcaaaaataaagaaagaaattctcaaagatttgtcccagaggacaatatacccagagtaccaatttccactcatggtatctggctaaatctagatagagctttagacaagagaaaaactcttgaccaatgggttgatagtttgatgatggattctgctctaacccttggaaaatttgaagcaccagatcttcaggtgtactatgaaactactcttactggagtagcaaaaaagtattatttctcttttaaagagactgccagagggaaagactggctagaagagataaaaaaattcaaaatctccgtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

178

Amino Acids

20.87

Weight (kDa)

8.75

Isoelectric Point (pI)

37.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000976)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g24112 FvH4_4g10003
rosa_chinensis RchiOBHm_Chr3g0487531 RchiOBHm_Chr5g0034781 RchiOBHm_Chr6g0277631
rosa_laevigata RLG00000021184
rosa_multiflora Rmu_sc0000144.1_g000006 Rmu_sc0000161.1_g000054 Rmu_sc0000383.1_g000008 Rmu_sc0000420.1_g000038 Rmu_sc0000429.1_g000090 Rmu_sc0000429.1_g000091 Rmu_sc0000453.1_g000018 Rmu_sc0000458.1_g000020 Rmu_sc0000483.1_g000003 Rmu_sc0000531.1_g000007 Rmu_sc0000595.1_g000055 Rmu_sc0000768.1_g000022 Rmu_sc0000855.1_g000012 Rmu_sc0000974.1_g000020 Rmu_sc0001018.1_g000020 Rmu_sc0001265.1_g000003 Rmu_sc0001407.1_g000004 Rmu_sc0001694.1_g000007 Rmu_sc0001785.1_g000004 Rmu_sc0001847.1_g000011 Rmu_sc0002148.1_g000003 Rmu_sc0002316.1_g000089 Rmu_sc0002501.1_g000027 Rmu_sc0002521.1_g000031 Rmu_sc0002845.1_g000028 Rmu_sc0003315.1_g000022 Rmu_sc0003371.1_g000015 Rmu_sc0003386.1_g000006 Rmu_sc0003415.1_g000012 Rmu_sc0003467.1_g000010 Rmu_sc0003583.1_g000002 Rmu_sc0003832.1_g000032 Rmu_sc0004094.1_g000040 Rmu_sc0004286.1_g000014 Rmu_sc0004344.1_g000014 Rmu_sc0004798.1_g000005 Rmu_sc0004846.1_g000001 Rmu_sc0005362.1_g000001 Rmu_sc0005481.1_g000002 Rmu_sc0006498.1_g000005 Rmu_sc0006968.1_g000011 Rmu_sc0007369.1_g000004 Rmu_sc0007727.1_g000016 Rmu_sc0008681.1_g000002 Rmu_sc0010278.1_g000009 Rmu_sc0011015.1_g000002 Rmu_sc0011611.1_g000004 Rmu_sc0012216.1_g000005 Rmu_sc0013333.1_g000001 Rmu_sc0016916.1_g000001 Rmu_sc0024220.1_g000001 Rmu_sc0036248.1_g000001 Rmu_sc0037776.1_g000001 Rmu_ssc0000052.1_g000014
rosa_samantha Rh4CG090000
rosa_wichuraiana Rw2G035730 Rw5G039910

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 4 cut(s) 93, 244, 398, 518
AcuI CTGAAG 1 cut(s) 401
AfaI GTAC 2 cut(s) 285, 425
AgsI TTSAA 4 cut(s) 100, 143, 404, 523
AjnI CCWGG 2 cut(s) 103, 132
AluBI AGCT 2 cut(s) 19, 326
AluI AGCT 2 cut(s) 19, 326
Alw26I GTCTC 1 cut(s) 473
ApoI RAATTY 4 cut(s) 93, 244, 398, 518
Asp700I GAANNNNTTC 1 cut(s) 95
AsuHPI GGTGA 1 cut(s) 169
BccI CCATC 1 cut(s) 367
BciT130I CCWGG 2 cut(s) 105, 134
BcoDI GTCTC 1 cut(s) 473
BfaI CTAG 2 cut(s) 317, 503
BglII AGATCT 1 cut(s) 412
Bme1390I CCNGG 2 cut(s) 105, 134
BmrFI CCNGG 2 cut(s) 105, 134
BplI GAGNNNNNCTC 2 cut(s) 328, 360
BpmI CTGGAG 1 cut(s) 465
BsaJI CCNNGG 1 cut(s) 391
Bse1I ACTGG 2 cut(s) 448, 503
BseBI CCWGG 2 cut(s) 105, 134
BseDI CCNNGG 1 cut(s) 391
BseNI ACTGG 2 cut(s) 448, 503
BslFI GGGAC 1 cut(s) 245
BsmAI GTCTC 1 cut(s) 473
BsmFI GGGAC 1 cut(s) 245
Bsp143I GATC 2 cut(s) 25, 412
BsrI ACTGG 2 cut(s) 448, 503
BssECI CCNNGG 1 cut(s) 391
BssMI GATC 2 cut(s) 25, 412
BssT1I CCWWGG 1 cut(s) 391
Bst2UI CCWGG 2 cut(s) 105, 134
Bst6I CTCTTC 1 cut(s) 501
BstKTI GATC 2 cut(s) 28, 415
BstMAI GTCTC 1 cut(s) 473
BstMBI GATC 2 cut(s) 25, 412
BstNI CCWGG 2 cut(s) 105, 134
BstSCI CCNGG 2 cut(s) 103, 132
BstX2I RGATCY 1 cut(s) 412
BstYI RGATCY 1 cut(s) 412
Csp6I GTAC 2 cut(s) 284, 424
CviAII CATG 1 cut(s) 299
CviJI RGCY 5 cut(s) 19, 218, 310, 326, 502
CviKI_1 RGCY 5 cut(s) 19, 218, 310, 326, 502
CviQI GTAC 2 cut(s) 284, 424
DpnI GATC 2 cut(s) 27, 414
DpnII GATC 2 cut(s) 25, 412
DraI TTTAAA 1 cut(s) 475
Eam1104I CTCTTC 1 cut(s) 501
EarI CTCTTC 1 cut(s) 501
Eco130I CCWWGG 1 cut(s) 391
Eco57I CTGAAG 1 cut(s) 401
EcoRII CCWGG 2 cut(s) 103, 132
EcoT14I CCWWGG 1 cut(s) 391
ErhI CCWWGG 1 cut(s) 391
FaeI CATG 1 cut(s) 302
FaiI YATR 6 cut(s) 24, 33, 275, 300, 429, 535
FaqI GGGAC 1 cut(s) 245
FatI CATG 1 cut(s) 298
FspBI CTAG 2 cut(s) 317, 503
GsuI CTGGAG 1 cut(s) 465
Hin1II CATG 1 cut(s) 302
HinfI GANTC 2 cut(s) 44, 377
HphI GGTGA 1 cut(s) 169
Hpy166II GTNNAC 1 cut(s) 424
Hpy188III TCNNGA 3 cut(s) 59, 317, 347
Hpy8I GTNNAC 1 cut(s) 424
HpyAV CCTTC 2 cut(s) 134, 146
HpyCH4V TGCA 1 cut(s) 51
Hsp92II CATG 1 cut(s) 302
Kzo9I GATC 2 cut(s) 25, 412
MaeI CTAG 2 cut(s) 317, 503
MalI GATC 2 cut(s) 27, 414
MboI GATC 2 cut(s) 25, 412
MboII GAAGA 4 cut(s) 95, 161, 407, 518
MflI RGATCY 1 cut(s) 412
MluCI AATT 5 cut(s) 93, 244, 288, 398, 518
MnlI CCTC 2 cut(s) 259, 482
MroXI GAANNNNTTC 1 cut(s) 95
MseI TTAA 2 cut(s) 6, 474
MspR9I CCNGG 2 cut(s) 105, 134
MvaI CCWGG 2 cut(s) 105, 134
NdeII GATC 2 cut(s) 25, 412
NlaIII CATG 1 cut(s) 302
PdmI GAANNNNTTC 1 cut(s) 95
PfeI GAWTC 2 cut(s) 44, 377
Psp6I CCWGG 2 cut(s) 103, 132
PspGI CCWGG 2 cut(s) 103, 132
PsuI RGATCY 1 cut(s) 412
RsaI GTAC 2 cut(s) 285, 425
RsaNI GTAC 2 cut(s) 284, 424
SaqAI TTAA 2 cut(s) 6, 474
Sau3AI GATC 2 cut(s) 25, 412
ScrFI CCNGG 2 cut(s) 105, 134
SetI ASST 3 cut(s) 21, 328, 423
Sse9I AATT 5 cut(s) 93, 244, 288, 398, 518
SspMI CTAG 2 cut(s) 317, 503
StyD4I CCNGG 2 cut(s) 103, 132
StyI CCWWGG 1 cut(s) 391
TaqI TCGA 1 cut(s) 81
TasI AATT 5 cut(s) 93, 244, 288, 398, 518
TatI WGTACW 1 cut(s) 423
TfiI GAWTC 2 cut(s) 44, 377
Tru1I TTAA 2 cut(s) 6, 474
Tru9I TTAA 2 cut(s) 6, 474
TspDTI ATGAA 4 cut(s) 51, 104, 163, 444
TspGWI ACGGA 1 cut(s) 520
XapI RAATTY 4 cut(s) 93, 244, 398, 518
XbaI TCTAGA 1 cut(s) 316
XmnI GAANNNNTTC 1 cut(s) 95
XspI CTAG 2 cut(s) 317, 503
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.