Rmu_sc0012638.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012638.1
Physical Location & Seq
Reverse (-)
9056 .. 11132
2077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012638.1_g000003.1.cds

Sequence Viewer

Length: 846 bp
atgaagaatccgatagaacttgagcagatcaagccatggtttcttggcaccattggtataatgggatcagccatgaaaatccttttgggaaatctcaatttcataaccttcaatttgatcacctcctttcctcttttctgcatgatgaagttcataccaagatcaccttatgacttttggcagcctagtttcatcatggaggcatcattggagctaaggcggctcattactcaccctggcactctgaaatcttctataccttcgattcaagattggacaatacgagtactcgatgcgtggctttttgacatgctcaagttcctcgttgcactcacatctatctactctgcttcaataatctatactactagtgttggcaagtcaatgagtctccgatatcttgttcagagttccatcaccaaaatttggtggcctgagcctataattacatatttttctctgtccctaatttcctccatctttttagaaggttttagacattggttaagggcaaggcctacaaatctgtacctgatcatcctacaatttttcgttccatttgtggccgttgccaaatggttggagttcaaagccttgacgaatgtagctgttgttgtttccgttttagaagacaatatcagagggccttttgaagcctactcaacctcgtcggagctaagcagaggaaatagactaagagggttggttttgataattctccattctagtgtgctctcaggtttgcttggtctgctttgggaatgtggtgaagtgggtcgtgttcatgatctaattttacgattgcaaggaccgggttgccgacaagaagttgatgatgaaggctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

281

Amino Acids

32.01

Weight (kDa)

8.76

Isoelectric Point (pI)

41.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000475)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G23830 AT1G23840 AT1G23850
fragaria_vesca FvH4_3g33230 FvH4_4g34710 FvH4_4g34711 FvH4_4g34720 FvH4_4g34730 FvH4_4g34740 FvH4_4g34760 FvH4_4g34761 FvH4_6g20500 FvH4_6g20520
malus_domestica MD13G1090000.v1.1 MD16G1090300.v1.1 MD16G1090400.v1.1 MD16G1090500.v1.1 MD16G1090600.v1.1
prunus_persica Prupe.1G255400_v2.0.a1 Prupe.1G255600_v2.0.a1 Prupe.1G255700_v2.0.a1 Prupe.1G255800_v2.0.a1
pyrus_communis pycom16g07740 pycom16g07760
rosa_chinensis RchiOBHm_Chr3g0476381 RchiOBHm_Chr4g0444081 RchiOBHm_Chr4g0444091 RchiOBHm_Chr4g0444101
rosa_laevigata RLG00000005856 RLG00000005857 RLG00000005858 RLG00000005859 RLG00000005860 RLG00000023773 RLG00000023775
rosa_multiflora Rmu_co8429785.1_g000001 Rmu_sc0000114.1_g000007 Rmu_sc0002177.1_g000009 Rmu_sc0012638.1_g000002 Rmu_sc0012638.1_g000003
rosa_roxburghii Rroxscaffold_5G00384630 Rroxscaffold_5G00384650 Rroxscaffold_5G00384660 Rroxscaffold_5G00384670 Rroxscaffold_5G00384680 Rroxscaffold_5G00384690 Rroxscaffold_6G00405320 Rroxscaffold_6G00405350
rosa_rugosa Rorug03G0153900 Rorug03G0154000 Rorug04G0349500 Rorug04G0349500 Rorug04G0349500
rosa_samantha Rh3AG205100 Rh3BG236700 Rh3CG231200 Rh3DG231000 Rh4AG410200 Rh4AG410300 Rh4AG410400 Rh4AG410500 Rh4AG410600 Rh4BG421300 Rh4BG421400 Rh4BG421500 Rh4BG421600 Rh4BG421700 Rh4BG421800 Rh4BG421900 Rh4BG422000 Rh4CG435700 Rh4CG435800 Rh4CG435900 Rh4CG436000 Rh4CG436100 Rh4CG436200 Rh4CG436300 Rh4CG436400 Rh4DG416600 Rh4DG416800 Rh4DG416900 Rh4DG417000 Rh4DG417100 Rh4DG417200 Rh4DG417300
rosa_wichuraiana Rw3G018640 Rw4G035240 Rw4G035250 Rw4G035260 Rw4G035270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 47
AccB7I CCANNNNNTGG 1 cut(s) 426
AciI CCGC 1 cut(s) 220
AclWI GGATC 1 cut(s) 73
AcoI YGGCCR 1 cut(s) 564
AcsI RAATTY 1 cut(s) 423
AfaI GTAC 2 cut(s) 288, 530
AfiI CCNNNNNNNGG 1 cut(s) 426
AgsI TTSAA 5 cut(s) 112, 269, 354, 589, 653
AhlI ACTAGT 1 cut(s) 368
AjnI CCWGG 1 cut(s) 235
AjuI GAANNNNNNNTTGG 2 cut(s) 68, 100
AluBI AGCT 3 cut(s) 214, 608, 676
AluI AGCT 3 cut(s) 214, 608, 676
Alw21I GWGCWC 1 cut(s) 735
Alw26I GTCTC 1 cut(s) 395
AlwI GGATC 1 cut(s) 73
AoxI GGCC 4 cut(s) 431, 515, 564, 644
ApeKI GCWGC 1 cut(s) 181
ApoI RAATTY 1 cut(s) 423
AspS9I GGNCC 2 cut(s) 644, 809
AsuC2I CCSGG 1 cut(s) 813
AsuHPI GGTGA 5 cut(s) 112, 156, 224, 409, 779
AvaII GGWCC 1 cut(s) 809
BanI GGYRCC 1 cut(s) 47
BbsI GAAGAC 1 cut(s) 636
Bbv12I GWGCWC 1 cut(s) 735
BbvI GCAGC 1 cut(s) 193
BccI CCATC 2 cut(s) 422, 485
BceAI ACGGC 1 cut(s) 551
BciT130I CCWGG 1 cut(s) 237
BclI TGATCA 2 cut(s) 117, 534
BcnI CCSGG 1 cut(s) 813
BcoDI GTCTC 1 cut(s) 395
BcuI ACTAGT 1 cut(s) 368
BfaI CTAG 3 cut(s) 186, 369, 726
BisI GCNGC 2 cut(s) 182, 221
BlpI GCTNAGC 1 cut(s) 677
BlsI GCNGC 2 cut(s) 183, 222
BmcAI AGTACT 1 cut(s) 288
Bme1390I CCNGG 2 cut(s) 237, 813
Bme18I GGWCC 1 cut(s) 809
BmgT120I GGNCC 2 cut(s) 644, 809
BmiI GGNNCC 1 cut(s) 49
BmrFI CCNGG 2 cut(s) 237, 813
BmsI GCATC 2 cut(s) 212, 283
BpiI GAAGAC 1 cut(s) 636
Bpu10I CCTNAGC 2 cut(s) 215, 435
Bpu1102I GCTNAGC 1 cut(s) 677
BpuEI CTTGAG 2 cut(s) 41, 299
BpuMI CCSGG 1 cut(s) 813
BsaJI CCNNGG 2 cut(s) 35, 235
Bsc4I CCNNNNNNNGG 1 cut(s) 426
BseBI CCWGG 1 cut(s) 237
BseDI CCNNGG 2 cut(s) 35, 235
BseGI GGATG 1 cut(s) 537
BseLI CCNNNNNNNGG 1 cut(s) 426
BseMII CTCAG 2 cut(s) 426, 750
BseXI GCAGC 1 cut(s) 193
BshFI GGCC 4 cut(s) 433, 517, 566, 646
BshNI GGYRCC 1 cut(s) 47
BsiHKAI GWGCWC 1 cut(s) 735
BsiSI CCGG 1 cut(s) 812
BslFI GGGAC 1 cut(s) 448
BslI CCNNNNNNNGG 1 cut(s) 426
BsmAI GTCTC 1 cut(s) 395
BsmFI GGGAC 1 cut(s) 448
BsnI GGCC 4 cut(s) 433, 517, 566, 646
Bsp1286I GDGCHC 1 cut(s) 735
Bsp143I GATC 6 cut(s) 27, 65, 117, 161, 534, 787
Bsp1720I GCTNAGC 1 cut(s) 677
Bsp19I CCATGG 1 cut(s) 35
BspACI CCGC 1 cut(s) 220
BspANI GGCC 4 cut(s) 433, 517, 566, 646
BspCNI CTCAG 2 cut(s) 427, 749
BspHI TCATGA 1 cut(s) 784
BspLI GGNNCC 1 cut(s) 49
BspPI GGATC 1 cut(s) 73
BspT107I GGYRCC 1 cut(s) 47
BssECI CCNNGG 2 cut(s) 35, 235
BssMI GATC 6 cut(s) 27, 65, 117, 161, 534, 787
BssT1I CCWWGG 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 237
BstDEI CTNAG 5 cut(s) 215, 435, 677, 695, 736
BstDSI CCRYGG 1 cut(s) 35
BstF5I GGATG 1 cut(s) 537
BstKTI GATC 6 cut(s) 30, 68, 120, 164, 537, 790
BstMAI GTCTC 1 cut(s) 395
BstMBI GATC 6 cut(s) 27, 65, 117, 161, 534, 787
BstMWI GCNNNNNNNGC 3 cut(s) 31, 220, 751
BstNI CCWGG 1 cut(s) 237
BstNSI RCATGY 1 cut(s) 313
BstSCI CCNGG 2 cut(s) 235, 811
BstV1I GCAGC 1 cut(s) 193
BstV2I GAAGAC 1 cut(s) 636
BstXI CCANNNNNNTGG 1 cut(s) 580
BsuRI GGCC 4 cut(s) 433, 517, 566, 646
BtgI CCRYGG 1 cut(s) 35
BtsCI GGATG 1 cut(s) 537
CciI TCATGA 1 cut(s) 784
Cfr13I GGNCC 2 cut(s) 644, 809
Csp6I GTAC 2 cut(s) 287, 529
CviAII CATG 6 cut(s) 36, 73, 142, 196, 310, 785
CviQI GTAC 2 cut(s) 287, 529
DdeI CTNAG 5 cut(s) 215, 435, 677, 695, 736
DpnI GATC 6 cut(s) 29, 67, 119, 163, 536, 789
DpnII GATC 6 cut(s) 27, 65, 117, 161, 534, 787
EaeI YGGCCR 1 cut(s) 564
Eco130I CCWWGG 1 cut(s) 35
Eco147I AGGCCT 1 cut(s) 517
Eco32I GATATC 1 cut(s) 398
Eco47I GGWCC 1 cut(s) 809
EcoO109I RGGNCCY 1 cut(s) 644
EcoRII CCWGG 1 cut(s) 235
EcoRV GATATC 1 cut(s) 398
EcoT14I CCWWGG 1 cut(s) 35
ErhI CCWWGG 1 cut(s) 35
FaeI CATG 6 cut(s) 39, 76, 145, 199, 313, 788
FalI AAGNNNNNCTT 2 cut(s) 151, 183
FaqI GGGAC 1 cut(s) 448
FatI CATG 6 cut(s) 35, 72, 141, 195, 309, 784
FbaI TGATCA 2 cut(s) 117, 534
Fnu4HI GCNGC 2 cut(s) 182, 221
FokI GGATG 1 cut(s) 524
Fsp4HI GCNGC 2 cut(s) 182, 221
FspBI CTAG 3 cut(s) 186, 369, 726
GluI GCNGC 2 cut(s) 182, 221
HaeIII GGCC 4 cut(s) 433, 517, 566, 646
HapII CCGG 1 cut(s) 812
Hin1II CATG 6 cut(s) 39, 76, 145, 199, 313, 788
HinfI GANTC 3 cut(s) 7, 265, 388
HpaII CCGG 1 cut(s) 812
HphI GGTGA 5 cut(s) 112, 156, 224, 409, 779
Hpy188I TCNGA 6 cut(s) 12, 246, 395, 408, 641, 673
Hpy188III TCNNGA 2 cut(s) 269, 785
Hpy99I CGWCG 1 cut(s) 673
HpyAV CCTTC 4 cut(s) 118, 270, 482, 833
HpyCH4V TGCA 3 cut(s) 141, 329, 805
HpyF10VI GCNNNNNNNGC 3 cut(s) 31, 220, 751
HpyF3I CTNAG 5 cut(s) 215, 435, 677, 695, 736
Hsp92II CATG 6 cut(s) 39, 76, 145, 199, 313, 788
Ksp22I TGATCA 2 cut(s) 117, 534
Kzo9I GATC 6 cut(s) 27, 65, 117, 161, 534, 787
LmnI GCTCC 2 cut(s) 211, 673
LpnPI CCDG 6 cut(s) 222, 249, 447, 545, 723, 825
Lsp1109I GCAGC 1 cut(s) 193
LweI GCATC 2 cut(s) 212, 283
MaeI CTAG 3 cut(s) 186, 369, 726
MalI GATC 6 cut(s) 29, 67, 119, 163, 536, 789
MboI GATC 6 cut(s) 27, 65, 117, 161, 534, 787
MboII GAAGA 3 cut(s) 16, 243, 641
MhlI GDGCHC 1 cut(s) 735
MluCI AATT 8 cut(s) 97, 112, 423, 444, 468, 545, 714, 792
MlyI GAGTC 1 cut(s) 397
MmeI TCCRAC 2 cut(s) 561, 651
MnlI CCTC 9 cut(s) 133, 141, 193, 332, 484, 635, 676, 677, 692
MseI TTAA 1 cut(s) 506
MslI CAYNNNNRTG 1 cut(s) 726
MspI CCGG 1 cut(s) 812
MspR9I CCNGG 2 cut(s) 237, 813
MvaI CCWGG 1 cut(s) 237
MwoI GCNNNNNNNGC 3 cut(s) 31, 220, 751
NciI CCSGG 1 cut(s) 813
NcoI CCATGG 1 cut(s) 35
NdeII GATC 6 cut(s) 27, 65, 117, 161, 534, 787
NlaIII CATG 6 cut(s) 39, 76, 145, 199, 313, 788
NlaIV GGNNCC 1 cut(s) 49
NspI RCATGY 1 cut(s) 313
PagI TCATGA 1 cut(s) 784
PceI AGGCCT 1 cut(s) 517
PfeI GAWTC 2 cut(s) 7, 265
PflMI CCANNNNNTGG 1 cut(s) 426
PkrI GCNGC 2 cut(s) 183, 222
PleI GAGTC 1 cut(s) 396
PpsI GAGTC 1 cut(s) 396
Psp6I CCWGG 1 cut(s) 235
PspGI CCWGG 1 cut(s) 235
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 2 cut(s) 644, 809
RsaI GTAC 2 cut(s) 288, 530
RsaNI GTAC 2 cut(s) 287, 529
RseI CAYNNNNRTG 1 cut(s) 726
SaqAI TTAA 1 cut(s) 506
SatI GCNGC 2 cut(s) 182, 221
Sau3AI GATC 6 cut(s) 27, 65, 117, 161, 534, 787
Sau96I GGNCC 2 cut(s) 644, 809
ScaI AGTACT 1 cut(s) 288
SchI GAGTC 1 cut(s) 397
ScrFI CCNGG 2 cut(s) 237, 813
SduI GDGCHC 1 cut(s) 735
SfaNI GCATC 2 cut(s) 212, 283
SinI GGWCC 1 cut(s) 809
SmiMI CAYNNNNRTG 1 cut(s) 726
SmlI CTYRAG 2 cut(s) 20, 314
SmoI CTYRAG 2 cut(s) 20, 314
SpeI ACTAGT 1 cut(s) 368
Sse9I AATT 8 cut(s) 97, 112, 423, 444, 468, 545, 714, 792
SseBI AGGCCT 1 cut(s) 517
SsiI CCGC 1 cut(s) 220
SspMI CTAG 3 cut(s) 186, 369, 726
StuI AGGCCT 1 cut(s) 517
StyD4I CCNGG 2 cut(s) 235, 811
StyI CCWWGG 1 cut(s) 35
TaqI TCGA 2 cut(s) 263, 291
TasI AATT 8 cut(s) 97, 112, 423, 444, 468, 545, 714, 792
TatI WGTACW 1 cut(s) 286
TauI GCSGC 1 cut(s) 223
TfiI GAWTC 2 cut(s) 7, 265
Tru1I TTAA 1 cut(s) 506
Tru9I TTAA 1 cut(s) 506
TseI GCWGC 1 cut(s) 181
TspDTI ATGAA 7 cut(s) 17, 89, 91, 142, 161, 181, 773
TspGWI ACGGA 1 cut(s) 610
Van91I CCANNNNNTGG 1 cut(s) 426
VpaK11BI GGWCC 1 cut(s) 809
XapI RAATTY 1 cut(s) 423
XceI RCATGY 1 cut(s) 313
XcmI CCANNNNNNNNNTGG 1 cut(s) 58
XspI CTAG 3 cut(s) 186, 369, 726
ZrmI AGTACT 1 cut(s) 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.