Rroxscaffold_1G00021360

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0000640
Physical Location & Seq
Forward (+)
26198651 .. 26207262
8612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00021360.1

Sequence Viewer

Length: 342 bp
ATGGAGTTTTTGATTCGTAAACAAAATAGAACGAGAAGATTACAAGTACAAGAAGGAGTTCTTAATCCAAAGGTGCTTCAAGGTGGAGGAAACACACACAAGGAGAGATCAAGGAGAGGAACTTTGGTGGTTCACTTGGATCGGATTAAAATCACGCTCCAAGGTGGATCCTTGAGATTGTATATGAAGAAGATTAAACAAGAAGAAGATTACAAGTACAAGAAAGAGTTCTTAATCCAAAGGTGCTTCAAGGTGGAGGAAACACACACAAGGAGAGATCAAGGAGAGGAACTTTGGTGGTTCACTTGGATCAGATTAAAATCACTCTCCAAGGGTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

13.67

Weight (kDa)

10.21

Isoelectric Point (pI)

55.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 147, 162, 175, 317
AfaI GTAC 2 cut(s) 48, 218
AgsI TTSAA 2 cut(s) 80, 250
AlwI GGATC 4 cut(s) 147, 162, 175, 317
Asp700I GAANNNNTTC 2 cut(s) 57, 227
BamHI GGATCC 1 cut(s) 167
BmiI GGNNCC 1 cut(s) 169
BpuEI CTTGAG 1 cut(s) 193
BsaBI GATNNNNATC 2 cut(s) 149, 319
BsaJI CCNNGG 2 cut(s) 160, 330
Bse8I GATNNNNATC 2 cut(s) 149, 319
BseDI CCNNGG 2 cut(s) 160, 330
BseJI GATNNNNATC 2 cut(s) 149, 319
Bsp143I GATC 5 cut(s) 107, 139, 167, 277, 309
BspLI GGNNCC 1 cut(s) 169
BspPI GGATC 4 cut(s) 147, 162, 175, 317
BssECI CCNNGG 2 cut(s) 160, 330
BssMI GATC 5 cut(s) 107, 139, 167, 277, 309
BssT1I CCWWGG 2 cut(s) 160, 330
BstKTI GATC 5 cut(s) 110, 142, 170, 280, 312
BstMBI GATC 5 cut(s) 107, 139, 167, 277, 309
BstX2I RGATCY 1 cut(s) 167
BstYI RGATCY 1 cut(s) 167
Csp6I GTAC 2 cut(s) 47, 217
CviQI GTAC 2 cut(s) 47, 217
DpnI GATC 5 cut(s) 109, 141, 169, 279, 311
DpnII GATC 5 cut(s) 107, 139, 167, 277, 309
Eco130I CCWWGG 2 cut(s) 160, 330
EcoT14I CCWWGG 2 cut(s) 160, 330
ErhI CCWWGG 2 cut(s) 160, 330
FaiI YATR 2 cut(s) 183, 185
FalI AAGNNNNNCTT 2 cut(s) 45, 77
HinfI GANTC 1 cut(s) 13
Hpy166II GTNNAC 3 cut(s) 20, 133, 303
Hpy188I TCNGA 2 cut(s) 144, 314
Hpy8I GTNNAC 3 cut(s) 20, 133, 303
HpyAV CCTTC 1 cut(s) 47
Kzo9I GATC 5 cut(s) 107, 139, 167, 277, 309
LmnI GCTCC 1 cut(s) 162
MalI GATC 5 cut(s) 109, 141, 169, 279, 311
MboI GATC 5 cut(s) 107, 139, 167, 277, 309
MboII GAAGA 5 cut(s) 48, 199, 202, 215, 218
MflI RGATCY 1 cut(s) 167
MnlI CCTC 4 cut(s) 80, 110, 250, 280
MroXI GAANNNNTTC 2 cut(s) 57, 227
MseI TTAA 5 cut(s) 63, 147, 195, 233, 317
NdeII GATC 5 cut(s) 107, 139, 167, 277, 309
NlaIV GGNNCC 1 cut(s) 169
PdmI GAANNNNTTC 2 cut(s) 57, 227
PfeI GAWTC 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 169
PsuI RGATCY 1 cut(s) 167
RsaI GTAC 2 cut(s) 48, 218
RsaNI GTAC 2 cut(s) 47, 217
SaqAI TTAA 5 cut(s) 63, 147, 195, 233, 317
Sau3AI GATC 5 cut(s) 107, 139, 167, 277, 309
SetI ASST 5 cut(s) 75, 85, 166, 245, 255
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
StyI CCWWGG 2 cut(s) 160, 330
TatI WGTACW 2 cut(s) 46, 216
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 5 cut(s) 63, 147, 195, 233, 317
Tru9I TTAA 5 cut(s) 63, 147, 195, 233, 317
TspDTI ATGAA 1 cut(s) 200
XmnI GAANNNNTTC 2 cut(s) 57, 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.