Rroxscaffold_4G00303830

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000640
Physical Location & Seq
Forward (+)
24263348 .. 24281763
18416 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00303830.1

Sequence Viewer

Length: 897 bp
ATGCACCCTCCACCCCATCGGGTACCGGAGGATAAACATCTTCTACCCCATCGGGTATCGACGGCACGATCCCTTCACCCCATCGGGTACCGGAGGCTTACATCCCCTACCCCATCGGGTATCGAAGCCAATCCCTCCCTACCCCATTGGGTACCGGAGGATAAACATCTTCTACCCCGTCGGTATCGACAAGAAGCTCCCTTCACCCCATGGGTACCGGAGGCTAACATCTTCTACCCCGTCGGTATCGACGCAAGCTCCCTACCCCATTGGGTACCGGAGGATAAACATCTTCTACCCCATCGGGTATCGACGACAAGCTCCCTACCCCATCGGGTGCCGGAGGATAAACATCTTCTACCCCATCGGGTATCGACGACAAACTCCCTTCACCCCATTGGGTACGGGAGGATAACCATCTTCTACCCCATCGGGTATCGACGGCAAGCTCCCTTCACCCCATTGGTACGGGAGGCTAACATCTTCTACCCCATCGGTATCGACGACAAACTCCCTTCACCCCATCGGGTACGGGAGGATAACCATCTTCTACCCCATCGGGTATCGACGGCAAGCTCCCTTCACCCCATTGGGTACCGGAGGCTAACATCTTCTACCCCATCGGGTATCGACGACAAACTCCCTTCACCCCATTGGGTACCGGAGGATAACCATCTTCTACCCCATCGGGTATCGACGCAAGCTCCGTTCACCCCATCGGGGTACCGGGAGGCTAACATCCCCTACCCCATCGGGCATCGAAGCCAATCCCTCTCCACCCCATTGGGTACCGGAGGCTCACAACATCTCCATCCCACCAATCCCGGGCAACTTCATTGTCCCACGACAAGTGGCTTACCTACAACTTCATTGTCCCACCACCACCAACACTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

298

Amino Acids

33.57

Weight (kDa)

9.67

Isoelectric Point (pI)

61.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 9 cut(s) 22, 87, 151, 214, 274, 594, 658, 723, 788
AclWI GGATC 1 cut(s) 63
AfiI CCNNNNNNNGG 2 cut(s) 720, 825
AluBI AGCT 6 cut(s) 197, 258, 321, 449, 576, 704
AluI AGCT 6 cut(s) 197, 258, 321, 449, 576, 704
AlwI GGATC 1 cut(s) 63
Ama87I CYCGRG 1 cut(s) 824
Asp718I GGTACC 9 cut(s) 22, 87, 151, 214, 274, 594, 658, 723, 788
AsuC2I CCSGG 3 cut(s) 728, 825, 826
AsuHPI GGTGA 8 cut(s) 68, 196, 383, 448, 510, 575, 639, 703
AvaI CYCGRG 1 cut(s) 824
BceAI ACGGC 3 cut(s) 78, 458, 585
BcnI CCSGG 3 cut(s) 728, 825, 826
Bme1390I CCNGG 3 cut(s) 728, 825, 826
BmeT110I CYCGRG 1 cut(s) 824
BmrFI CCNGG 3 cut(s) 728, 825, 826
BmsI GCATC 1 cut(s) 766
BpuMI CCSGG 3 cut(s) 728, 825, 826
BsaBI GATNNNNATC 7 cut(s) 36, 165, 288, 351, 416, 543, 672
BsaJI CCNNGG 2 cut(s) 209, 824
BsaWI WCCGGW 8 cut(s) 25, 90, 154, 217, 277, 597, 661, 791
BsaXI ACNNNNNCTCC 6 cut(s) 242, 272, 688, 718, 792, 822
Bsc4I CCNNNNNNNGG 2 cut(s) 720, 825
Bse8I GATNNNNATC 7 cut(s) 36, 165, 288, 351, 416, 543, 672
BseDI CCNNGG 2 cut(s) 209, 824
BseGI GGATG 3 cut(s) 101, 738, 811
BseJI GATNNNNATC 7 cut(s) 36, 165, 288, 351, 416, 543, 672
BseLI CCNNNNNNNGG 2 cut(s) 720, 825
BsiHKCI CYCGRG 1 cut(s) 824
BslFI GGGAC 2 cut(s) 825, 859
BslI CCNNNNNNNGG 2 cut(s) 720, 825
BsmFI GGGAC 2 cut(s) 825, 859
BsoBI CYCGRG 1 cut(s) 824
Bsp143I GATC 1 cut(s) 68
Bsp19I CCATGG 1 cut(s) 209
BspPI GGATC 1 cut(s) 63
BssECI CCNNGG 2 cut(s) 209, 824
BssMI GATC 1 cut(s) 68
BssT1I CCWWGG 1 cut(s) 209
BstC8I GCNNGC 4 cut(s) 256, 447, 574, 702
BstDSI CCRYGG 1 cut(s) 209
BstF5I GGATG 3 cut(s) 101, 738, 811
BstKTI GATC 1 cut(s) 71
BstMBI GATC 1 cut(s) 68
BstSCI CCNGG 3 cut(s) 726, 823, 824
BstXI CCANNNNNNTGG 1 cut(s) 784
BtgI CCRYGG 1 cut(s) 209
BtsCI GGATG 3 cut(s) 101, 738, 811
Cac8I GCNNGC 4 cut(s) 256, 447, 574, 702
Cfr9I CCCGGG 1 cut(s) 824
CseI GACGC 2 cut(s) 260, 706
CviAII CATG 1 cut(s) 210
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
Eco130I CCWWGG 1 cut(s) 209
Eco88I CYCGRG 1 cut(s) 824
EcoT14I CCWWGG 1 cut(s) 209
ErhI CCWWGG 1 cut(s) 209
FaeI CATG 1 cut(s) 213
FaiI YATR 1 cut(s) 211
FaqI GGGAC 2 cut(s) 825, 859
FatI CATG 1 cut(s) 209
FokI GGATG 3 cut(s) 88, 725, 798
HgaI GACGC 2 cut(s) 260, 706
Hin1II CATG 1 cut(s) 213
HphI GGTGA 8 cut(s) 68, 196, 383, 448, 510, 575, 639, 703
Hpy166II GTNNAC 1 cut(s) 711
Hpy8I GTNNAC 1 cut(s) 711
HpyAV CCTTC 7 cut(s) 83, 211, 398, 463, 525, 590, 654
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 213
KpnI GGTACC 9 cut(s) 26, 91, 155, 218, 278, 598, 662, 727, 792
Kzo9I GATC 1 cut(s) 68
LmnI GCTCC 6 cut(s) 202, 263, 326, 454, 581, 709
LweI GCATC 1 cut(s) 766
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MspR9I CCNGG 3 cut(s) 728, 825, 826
NciI CCSGG 3 cut(s) 728, 825, 826
NcoI CCATGG 1 cut(s) 209
NdeII GATC 1 cut(s) 68
NlaIII CATG 1 cut(s) 213
PcsI WCGNNNNNNNCGW 2 cut(s) 501, 704
Sau3AI GATC 1 cut(s) 68
ScrFI CCNGG 3 cut(s) 728, 825, 826
SetI ASST 7 cut(s) 199, 260, 323, 451, 578, 706, 862
SfaNI GCATC 1 cut(s) 766
SmaI CCCGGG 1 cut(s) 826
StyD4I CCNGG 3 cut(s) 726, 823, 824
StyI CCWWGG 1 cut(s) 209
TspDTI ATGAA 2 cut(s) 824, 858
TspGWI ACGGA 1 cut(s) 696
TspMI CCCGGG 1 cut(s) 824
XmaI CCCGGG 1 cut(s) 824
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.