Rroxscaffold_4G00305880

Leucine-rich repeats, outliers

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000640
Physical Location & Seq
Forward (+)
26600179 .. 26612261
12083 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00305880.1

Sequence Viewer

Length: 315 bp
ATGAATCGCCTGGGTCATTTAACACGGCTCTATCTGAGAGGTTGCAAGAGACTGAAATCAATACCAGAACTTTCATCGAGTATACAAGAAATCGATGCCCAAGATTGCACATCTTTGGAGATAGTTTCAACACCACAGCCTCCGAGAATATTACAAGCCCAAGGAGTACAAGAAGGAGTTCTTAATTCAAGGTGCTTCAAGGTGGAGGAAACACACACAAGGAGAGATCAAGGAGAGGAACTTTGGTGGTTCACTTGGATCGGATTGAGATCACGCTCCAAGGGGAGAATCAAAAATGGAGTTTTTGATTCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRR_8

Protein Analysis

104

Amino Acids

11.98

Weight (kDa)

9.3

Isoelectric Point (pI)

62.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 82
AclWI GGATC 1 cut(s) 266
AfaI GTAC 1 cut(s) 168
AgsI TTSAA 3 cut(s) 129, 189, 199
AjnI CCWGG 1 cut(s) 9
Alw26I GTCTC 1 cut(s) 43
AlwI GGATC 1 cut(s) 266
Asp700I GAANNNNTTC 1 cut(s) 177
BceAI ACGGC 1 cut(s) 41
BciT130I CCWGG 1 cut(s) 11
BcoDI GTCTC 1 cut(s) 43
Bme1390I CCNGG 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 11
BmsI GCATC 1 cut(s) 85
Bsa29I ATCGAT 1 cut(s) 93
BsaBI GATNNNNATC 1 cut(s) 268
BsaJI CCNNGG 3 cut(s) 10, 160, 279
Bse8I GATNNNNATC 1 cut(s) 268
BseBI CCWGG 1 cut(s) 11
BseCI ATCGAT 1 cut(s) 93
BseDI CCNNGG 3 cut(s) 10, 160, 279
BseJI GATNNNNATC 1 cut(s) 268
BseMII CTCAG 1 cut(s) 26
BshVI ATCGAT 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 43
Bsp143I GATC 3 cut(s) 226, 258, 269
BspCNI CTCAG 1 cut(s) 27
BspDI ATCGAT 1 cut(s) 93
BspPI GGATC 1 cut(s) 266
BssECI CCNNGG 3 cut(s) 10, 160, 279
BssMI GATC 3 cut(s) 226, 258, 269
BssNAI GTATAC 1 cut(s) 83
BssT1I CCWWGG 2 cut(s) 160, 279
Bst1107I GTATAC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 11
BstDEI CTNAG 1 cut(s) 35
BstKTI GATC 3 cut(s) 229, 261, 272
BstMAI GTCTC 1 cut(s) 43
BstMBI GATC 3 cut(s) 226, 258, 269
BstNI CCWGG 1 cut(s) 11
BstSCI CCNGG 1 cut(s) 9
BstZ17I GTATAC 1 cut(s) 83
Bsu15I ATCGAT 1 cut(s) 93
BsuTUI ATCGAT 1 cut(s) 93
ClaI ATCGAT 1 cut(s) 93
Csp6I GTAC 1 cut(s) 167
CviJI RGCY 3 cut(s) 28, 139, 158
CviKI_1 RGCY 3 cut(s) 28, 139, 158
CviQI GTAC 1 cut(s) 167
DdeI CTNAG 1 cut(s) 35
DpnI GATC 3 cut(s) 228, 260, 271
DpnII GATC 3 cut(s) 226, 258, 269
Eco130I CCWWGG 2 cut(s) 160, 279
EcoRII CCWGG 1 cut(s) 9
EcoT14I CCWWGG 2 cut(s) 160, 279
ErhI CCWWGG 2 cut(s) 160, 279
FaiI YATR 1 cut(s) 83
FalI AAGNNNNNCTT 2 cut(s) 165, 197
FblI GTMKAC 1 cut(s) 82
HinfI GANTC 3 cut(s) 4, 288, 308
Hpy166II GTNNAC 2 cut(s) 83, 252
Hpy188I TCNGA 3 cut(s) 36, 144, 263
Hpy8I GTNNAC 2 cut(s) 83, 252
HpyAV CCTTC 1 cut(s) 167
HpyCH4V TGCA 2 cut(s) 45, 108
HpyF3I CTNAG 1 cut(s) 35
Kzo9I GATC 3 cut(s) 226, 258, 269
LmnI GCTCC 1 cut(s) 281
LpnPI CCDG 2 cut(s) 23, 78
LweI GCATC 1 cut(s) 85
MalI GATC 3 cut(s) 228, 260, 271
MboI GATC 3 cut(s) 226, 258, 269
MluCI AATT 1 cut(s) 184
MnlI CCTC 4 cut(s) 32, 150, 199, 229
MroXI GAANNNNTTC 1 cut(s) 177
MseI TTAA 2 cut(s) 20, 183
MspR9I CCNGG 1 cut(s) 11
MvaI CCWGG 1 cut(s) 11
NdeII GATC 3 cut(s) 226, 258, 269
PdmI GAANNNNTTC 1 cut(s) 177
PfeI GAWTC 3 cut(s) 4, 288, 308
Psp6I CCWGG 1 cut(s) 9
PspGI CCWGG 1 cut(s) 9
RsaI GTAC 1 cut(s) 168
RsaNI GTAC 1 cut(s) 167
SaqAI TTAA 2 cut(s) 20, 183
Sau3AI GATC 3 cut(s) 226, 258, 269
ScrFI CCNGG 1 cut(s) 11
SetI ASST 3 cut(s) 43, 194, 204
SfaNI GCATC 1 cut(s) 85
Sse9I AATT 1 cut(s) 184
SspI AATATT 1 cut(s) 150
StyD4I CCNGG 1 cut(s) 9
StyI CCWWGG 2 cut(s) 160, 279
TaqI TCGA 2 cut(s) 77, 93
TasI AATT 1 cut(s) 184
TatI WGTACW 1 cut(s) 166
TfiI GAWTC 3 cut(s) 4, 288, 308
Tru1I TTAA 2 cut(s) 20, 183
Tru9I TTAA 2 cut(s) 20, 183
TspDTI ATGAA 2 cut(s) 17, 63
XmiI GTMKAC 1 cut(s) 82
XmnI GAANNNNTTC 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.