Rh2AG481200

Mitochondrial inner membrane protease

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
70103033 .. 70106920
3888 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG481200.1

Sequence Viewer

Length: 285 bp
ATGGTGTGTAGTAATCACATGAACATGCAAGATGAGGTCAACCAAGTAGTGATACATGAGCTAATTCATGCTTTTGATGATTGTCGGGCTGCTCCGATGGTGAACTGGGCTAATTGCCCTCATCATGCTTGTAGCGAGATTCGTGCTGGCCATCTTAGTGGTGATTGCCACTGTAAACGTGAATTTTTGCTGTGCCAAGAAGATTCGAGAATTGTGAACAAATTAGCAAATGATCCTGAACTGACATTACCTTATAACAGGGCGGACTTCACTTGGCCTGTATAG

Protein Analysis

94

Amino Acids

10.77

Weight (kDa)

5.49

Isoelectric Point (pI)

40.22

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_M76 PF09768 1 - 64 2.8e-23 Peptidase M76 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 255
AciI CCGC 1 cut(s) 263
AclWI GGATC 1 cut(s) 227
AcoI YGGCCR 1 cut(s) 148
AcsI RAATTY 1 cut(s) 182
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
AlwI GGATC 1 cut(s) 227
AoxI GGCC 2 cut(s) 148, 275
ApeKI GCWGC 1 cut(s) 89
ApoI RAATTY 1 cut(s) 182
AsuHPI GGTGA 2 cut(s) 112, 173
BalI TGGCCA 1 cut(s) 150
BbvI GCAGC 1 cut(s) 76
BccI CCATC 2 cut(s) 91, 159
BcgI CGANNNNNNTGC 2 cut(s) 125, 159
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
BmrI ACTGGG 1 cut(s) 115
BmuI ACTGGG 1 cut(s) 115
Bse1I ACTGG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 110
BseXI GCAGC 1 cut(s) 76
BshFI GGCC 2 cut(s) 150, 277
BsnI GGCC 2 cut(s) 150, 277
Bsp143I GATC 1 cut(s) 232
BspACI CCGC 1 cut(s) 263
BspANI GGCC 2 cut(s) 150, 277
BspPI GGATC 1 cut(s) 227
BsrI ACTGG 1 cut(s) 110
BssMI GATC 1 cut(s) 232
Bst4CI ACNGT 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 155
BstKTI GATC 1 cut(s) 235
BstMBI GATC 1 cut(s) 232
BstNSI RCATGY 1 cut(s) 28
BstV1I GCAGC 1 cut(s) 76
BstXI CCANNNNNNTGG 1 cut(s) 158
BsuRI GGCC 2 cut(s) 150, 277
BtsIMutI CAGTG 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 148
CviAII CATG 5 cut(s) 19, 25, 56, 68, 125
CviJI RGCY 5 cut(s) 61, 89, 110, 150, 277
CviKI_1 RGCY 5 cut(s) 61, 89, 110, 150, 277
DdeI CTNAG 1 cut(s) 155
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
EaeI YGGCCR 1 cut(s) 148
EciI GGCGGA 1 cut(s) 278
FaeI CATG 5 cut(s) 22, 28, 59, 71, 128
FaiI YATR 7 cut(s) 20, 26, 57, 69, 126, 255, 283
FatI CATG 5 cut(s) 18, 24, 55, 67, 124
Fnu4HI GCNGC 1 cut(s) 90
Fsp4HI GCNGC 1 cut(s) 90
GluI GCNGC 1 cut(s) 90
HaeIII GGCC 2 cut(s) 150, 277
Hin1II CATG 5 cut(s) 22, 28, 59, 71, 128
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HinfI GANTC 2 cut(s) 139, 203
HphI GGTGA 2 cut(s) 112, 173
Hpy166II GTNNAC 4 cut(s) 40, 103, 176, 217
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 2 cut(s) 207, 236
Hpy8I GTNNAC 4 cut(s) 40, 103, 176, 217
HpyCH4III ACNGT 1 cut(s) 173
HpyCH4IV ACGT 1 cut(s) 178
HpyCH4V TGCA 1 cut(s) 28
HpyF3I CTNAG 1 cut(s) 155
HpySE526I ACGT 1 cut(s) 178
Hsp92II CATG 5 cut(s) 22, 28, 59, 71, 128
Kzo9I GATC 1 cut(s) 232
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 4 cut(s) 91, 132, 244, 249
Lsp1109I GCAGC 1 cut(s) 76
MaeII ACGT 1 cut(s) 178
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MboII GAAGA 1 cut(s) 212
MlsI TGGCCA 1 cut(s) 150
MluCI AATT 5 cut(s) 63, 112, 182, 210, 221
MluNI TGGCCA 1 cut(s) 150
MnlI CCTC 2 cut(s) 28, 129
Mox20I TGGCCA 1 cut(s) 150
MscI TGGCCA 1 cut(s) 150
MslI CAYNNNNRTG 2 cut(s) 23, 156
Msp20I TGGCCA 1 cut(s) 150
NdeII GATC 1 cut(s) 232
NlaIII CATG 5 cut(s) 22, 28, 59, 71, 128
NspI RCATGY 1 cut(s) 28
PfeI GAWTC 2 cut(s) 139, 203
PkrI GCNGC 1 cut(s) 91
PsiI TTATAA 1 cut(s) 255
PsrI GAACNNNNNNTAC 2 cut(s) 231, 263
RseI CAYNNNNRTG 2 cut(s) 23, 156
SatI GCNGC 1 cut(s) 90
Sau3AI GATC 1 cut(s) 232
SetI ASST 4 cut(s) 39, 63, 181, 253
SmiMI CAYNNNNRTG 2 cut(s) 23, 156
Sse9I AATT 5 cut(s) 63, 112, 182, 210, 221
SsiI CCGC 1 cut(s) 263
TaaI ACNGT 1 cut(s) 173
TaiI ACGT 1 cut(s) 181
TaqI TCGA 1 cut(s) 206
TasI AATT 5 cut(s) 63, 112, 182, 210, 221
TfiI GAWTC 2 cut(s) 139, 203
TscAI CASTG 1 cut(s) 176
TseI GCWGC 1 cut(s) 89
TspDTI ATGAA 2 cut(s) 35, 56
TspRI CASTG 1 cut(s) 176
XapI RAATTY 1 cut(s) 182
XceI RCATGY 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.