Rh6DG458300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0000640
Physical Location & Seq
Forward (+)
62828402 .. 62828551
150 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG458300.1

Sequence Viewer

Length: 150 bp
ATGAACAAGGTAGTAGATCCAAAATCCATGCAGATCCCCCACTATCGATTTTGGATCTGCTCCGATGGTGAAGTTTCTGCTGGAGCATCTGGAGAAATCGATTTTCGATCTGCTCCGACGGTGAAGTTTCTGCTGGAGCATCAGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.51

Weight (kDa)

6.0

Isoelectric Point (pI)

30.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 11, 28, 62
AlwI GGATC 3 cut(s) 11, 28, 62
AsuHPI GGTGA 2 cut(s) 80, 133
BccI CCATC 1 cut(s) 59
BmsI GCATC 1 cut(s) 95
BpmI CTGGAG 2 cut(s) 102, 111
Bsa29I ATCGAT 2 cut(s) 46, 99
BsaXI ACNNNNNCTCC 1 cut(s) 128
BseCI ATCGAT 2 cut(s) 46, 99
BshVI ATCGAT 2 cut(s) 46, 99
Bsp143I GATC 4 cut(s) 16, 33, 54, 107
BspDI ATCGAT 2 cut(s) 46, 99
BspPI GGATC 3 cut(s) 11, 28, 62
BssMI GATC 4 cut(s) 16, 33, 54, 107
Bst4CI ACNGT 1 cut(s) 121
BstKTI GATC 4 cut(s) 19, 36, 57, 110
BstMBI GATC 4 cut(s) 16, 33, 54, 107
BstX2I RGATCY 3 cut(s) 16, 33, 54
BstYI RGATCY 3 cut(s) 16, 33, 54
Bsu15I ATCGAT 2 cut(s) 46, 99
BsuTUI ATCGAT 2 cut(s) 46, 99
ClaI ATCGAT 2 cut(s) 46, 99
CviAII CATG 1 cut(s) 28
DpnI GATC 4 cut(s) 18, 35, 56, 109
DpnII GATC 4 cut(s) 16, 33, 54, 107
FaeI CATG 1 cut(s) 31
FaiI YATR 1 cut(s) 29
FatI CATG 1 cut(s) 27
GsuI CTGGAG 2 cut(s) 102, 111
Hin1II CATG 1 cut(s) 31
HphI GGTGA 2 cut(s) 80, 133
Hpy188I TCNGA 2 cut(s) 64, 117
Hpy188III TCNNGA 1 cut(s) 90
Hpy99I CGWCG 1 cut(s) 121
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 31
Hsp92II CATG 1 cut(s) 31
Kzo9I GATC 4 cut(s) 16, 33, 54, 107
LmnI GCTCC 4 cut(s) 65, 83, 118, 136
LpnPI CCDG 3 cut(s) 66, 75, 119
LweI GCATC 1 cut(s) 95
MalI GATC 4 cut(s) 18, 35, 56, 109
MboI GATC 4 cut(s) 16, 33, 54, 107
MflI RGATCY 3 cut(s) 16, 33, 54
MmeI TCCRAC 1 cut(s) 140
MseI TTAA 1 cut(s) 148
NdeII GATC 4 cut(s) 16, 33, 54, 107
NlaIII CATG 1 cut(s) 31
PsuI RGATCY 3 cut(s) 16, 33, 54
SaqAI TTAA 1 cut(s) 148
Sau3AI GATC 4 cut(s) 16, 33, 54, 107
SetI ASST 1 cut(s) 12
SfaNI GCATC 1 cut(s) 95
SgeI CNNG 5 cut(s) 19, 40, 93, 102, 146
TaaI ACNGT 1 cut(s) 121
TaqI TCGA 3 cut(s) 46, 99, 106
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.