Rroxscaffold_3G00238130

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
26318909 .. 26328129
9221 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00238130.1

Sequence Viewer

Length: 459 bp
ATGATGCGGCCAAGAAGCCTCGATTCCCAAGCCTTAATGCTCGATTTCGGTGTTCAAGTGCCTCCTTTTCATGCTAATTCTTTAGCTACATTTGGATATTGCCCTCCCGAGATTCTAAACGTGTGCTCTTCCGCTACTAATCCGATTGCATGCCTCATAGTGGAATTCCTTGCAATGGCCAGATCCTTAGAGATCATATCCTTTTGTGGCTCTACTTGTTACATCAAGGAGGAGTTTACAAGCACAAAGAGTTCTAAATCCAAGGTGCTTCAAGGTGGAGGAAACACATACAAAGAGAGATCAAGGAGAGGAACTTTGGTGGTTCACTTGGATCTGATTGAAATCACGCTCCAAGGGAACCCTTCAGATATTGATGAGAAATTACCTAGAGGTAAAACTGAAATAGTTCATCAAATTAGTCAAATAGATACCAGAATGCAAGGCAATCCTCCTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

152

Amino Acids

16.72

Weight (kDa)

6.81

Isoelectric Point (pI)

54.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 7, 132
AclWI GGATC 2 cut(s) 177, 339
AcoI YGGCCR 2 cut(s) 8, 177
AcsI RAATTY 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 348
AfiI CCNNNNNNNGG 2 cut(s) 160, 175
AflIII ACRYGT 1 cut(s) 120
AgsI TTSAA 3 cut(s) 56, 272, 341
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw21I GWGCWC 1 cut(s) 128
AlwI GGATC 2 cut(s) 177, 339
Ama87I CYCGRG 1 cut(s) 107
AoxI GGCC 2 cut(s) 8, 177
ApoI RAATTY 1 cut(s) 164
Asp700I GAANNNNTTC 1 cut(s) 405
AvaI CYCGRG 1 cut(s) 107
BalI TGGCCA 1 cut(s) 179
Bbv12I GWGCWC 1 cut(s) 128
BfaI CTAG 1 cut(s) 387
BisI GCNGC 1 cut(s) 8
BlsI GCNGC 1 cut(s) 9
BmeT110I CYCGRG 1 cut(s) 107
BmiI GGNNCC 1 cut(s) 359
BsaBI GATNNNNATC 1 cut(s) 341
BsaJI CCNNGG 2 cut(s) 261, 352
Bsc4I CCNNNNNNNGG 2 cut(s) 160, 175
Bse3DI GCAATG 1 cut(s) 180
Bse8I GATNNNNATC 1 cut(s) 341
BseDI CCNNGG 2 cut(s) 261, 352
BseJI GATNNNNATC 1 cut(s) 341
BseLI CCNNNNNNNGG 2 cut(s) 160, 175
BseMI GCAATG 1 cut(s) 180
BseRI GAGGAG 1 cut(s) 245
BshFI GGCC 2 cut(s) 10, 179
BsiHKAI GWGCWC 1 cut(s) 128
BsiHKCI CYCGRG 1 cut(s) 107
BslI CCNNNNNNNGG 2 cut(s) 160, 175
BsmI GAATGC 1 cut(s) 441
BsnI GGCC 2 cut(s) 10, 179
BsoBI CYCGRG 1 cut(s) 107
Bsp1286I GDGCHC 1 cut(s) 128
Bsp143I GATC 4 cut(s) 182, 192, 299, 331
BspACI CCGC 2 cut(s) 7, 132
BspANI GGCC 2 cut(s) 10, 179
BspLI GGNNCC 1 cut(s) 359
BspPI GGATC 2 cut(s) 177, 339
BspQI GCTCTTC 1 cut(s) 133
BsrDI GCAATG 1 cut(s) 180
BssECI CCNNGG 2 cut(s) 261, 352
BssMI GATC 4 cut(s) 182, 192, 299, 331
BssT1I CCWWGG 2 cut(s) 261, 352
Bst6I CTCTTC 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 187
BstKTI GATC 4 cut(s) 185, 195, 302, 334
BstMBI GATC 4 cut(s) 182, 192, 299, 331
BstNSI RCATGY 1 cut(s) 153
BstX2I RGATCY 2 cut(s) 182, 331
BstYI RGATCY 2 cut(s) 182, 331
BsuRI GGCC 2 cut(s) 10, 179
Cac8I GCNNGC 1 cut(s) 151
CviAII CATG 2 cut(s) 71, 150
CviJI RGCY 6 cut(s) 10, 18, 32, 86, 179, 210
CviKI_1 RGCY 6 cut(s) 10, 18, 32, 86, 179, 210
DdeI CTNAG 1 cut(s) 187
DpnI GATC 4 cut(s) 184, 194, 301, 333
DpnII GATC 4 cut(s) 182, 192, 299, 331
EaeI YGGCCR 2 cut(s) 8, 177
Eam1104I CTCTTC 1 cut(s) 133
EarI CTCTTC 1 cut(s) 133
Eco130I CCWWGG 2 cut(s) 261, 352
Eco57I CTGAAG 1 cut(s) 348
Eco88I CYCGRG 1 cut(s) 107
EcoRI GAATTC 1 cut(s) 164
EcoT14I CCWWGG 2 cut(s) 261, 352
ErhI CCWWGG 2 cut(s) 261, 352
FaeI CATG 2 cut(s) 74, 153
FaiI YATR 6 cut(s) 72, 151, 158, 197, 289, 457
FatI CATG 2 cut(s) 70, 149
Fnu4HI GCNGC 1 cut(s) 8
Fsp4HI GCNGC 1 cut(s) 8
FspBI CTAG 1 cut(s) 387
GluI GCNGC 1 cut(s) 8
HaeIII GGCC 2 cut(s) 10, 179
Hin1II CATG 2 cut(s) 74, 153
HinfI GANTC 2 cut(s) 23, 112
Hpy166II GTNNAC 2 cut(s) 237, 325
Hpy188I TCNGA 3 cut(s) 144, 336, 367
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 237, 325
HpyAV CCTTC 1 cut(s) 372
HpyCH4IV ACGT 1 cut(s) 120
HpyCH4V TGCA 4 cut(s) 149, 173, 439, 455
HpyF3I CTNAG 1 cut(s) 187
HpySE526I ACGT 1 cut(s) 120
Hsp92II CATG 2 cut(s) 74, 153
Kzo9I GATC 4 cut(s) 182, 192, 299, 331
LguI GCTCTTC 1 cut(s) 133
LmnI GCTCC 1 cut(s) 354
LpnPI CCDG 2 cut(s) 193, 445
MaeI CTAG 1 cut(s) 387
MaeII ACGT 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 218
MalI GATC 4 cut(s) 184, 194, 301, 333
MboI GATC 4 cut(s) 182, 192, 299, 331
MboII GAAGA 1 cut(s) 120
MflI RGATCY 2 cut(s) 182, 331
MhlI GDGCHC 1 cut(s) 128
MlsI TGGCCA 1 cut(s) 179
MluCI AATT 4 cut(s) 76, 164, 380, 414
MluNI TGGCCA 1 cut(s) 179
MnlI CCTC 9 cut(s) 29, 72, 114, 164, 223, 272, 302, 383, 459
Mox20I TGGCCA 1 cut(s) 179
MroXI GAANNNNTTC 1 cut(s) 405
MscI TGGCCA 1 cut(s) 179
MseI TTAA 1 cut(s) 35
Msp20I TGGCCA 1 cut(s) 179
Mva1269I GAATGC 1 cut(s) 441
NdeII GATC 4 cut(s) 182, 192, 299, 331
NlaIII CATG 2 cut(s) 74, 153
NlaIV GGNNCC 1 cut(s) 359
NspI RCATGY 1 cut(s) 153
PaeI GCATGC 1 cut(s) 153
PciSI GCTCTTC 1 cut(s) 133
PctI GAATGC 1 cut(s) 441
PdmI GAANNNNTTC 1 cut(s) 405
PfeI GAWTC 2 cut(s) 23, 112
PkrI GCNGC 1 cut(s) 9
PspN4I GGNNCC 1 cut(s) 359
PsuI RGATCY 2 cut(s) 182, 331
SapI GCTCTTC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 35
SatI GCNGC 1 cut(s) 8
Sau3AI GATC 4 cut(s) 182, 192, 299, 331
SduI GDGCHC 1 cut(s) 128
SetI ASST 6 cut(s) 88, 123, 267, 277, 388, 394
SphI GCATGC 1 cut(s) 153
Sse9I AATT 4 cut(s) 76, 164, 380, 414
SsiI CCGC 2 cut(s) 7, 132
SspMI CTAG 1 cut(s) 387
StyI CCWWGG 2 cut(s) 261, 352
TaiI ACGT 1 cut(s) 123
TaqI TCGA 2 cut(s) 21, 42
TasI AATT 4 cut(s) 76, 164, 380, 414
TauI GCSGC 1 cut(s) 10
TfiI GAWTC 2 cut(s) 23, 112
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TspDTI ATGAA 2 cut(s) 59, 398
XapI RAATTY 1 cut(s) 164
XceI RCATGY 1 cut(s) 153
XmnI GAANNNNTTC 1 cut(s) 405
XspI CTAG 1 cut(s) 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.