Rroxscaffold_1G00029440

UDP-glucose glycoprotein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
38014938 .. 38029543
14606 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00029440.1

Sequence Viewer

Length: 327 bp
ATGGCCGAGGCTCCGAAACTCGTGGAGGAAACACACACAAGGAGAGATCAAGGAGAGGAACTTTGGTGGTTCACTTGGATCGGATTGAGATCACGCTCCAAGGGTGGAGGAAACACACACAAGGAGAGATCAAGGAGAGGAACTTTGGTGGTTCACTTGGATCGGATTGAGATCACGCTCCAAGGATCTGCATCCCCAAGATTGGTGCTTTACCGACAATTAGCTGAAGAATCTCTCTCATCTTTCCCACCGCTTGATGAAACTAATTCAAGAAATGCCAGCGAAAAGGAGGAATTGAAGGACCACCAGCCACCGGTCGAGTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0001101 GO:0002218 GO:0002253 GO:0002376 GO:0002682 GO:0002684 GO:0003674 GO:0003824 GO:0003980 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0006011 GO:0006139 GO:0006457 GO:0006458 GO:0006464 GO:0006486 GO:0006487 GO:0006508 GO:0006515 GO:0006725 GO:0006793 GO:0006807 GO:0006950 GO:0006952 GO:0006955 GO:0006986 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0008194 GO:0008219 GO:0009056 GO:0009057 GO:0009058 GO:0009059 GO:0009100 GO:0009101 GO:0009225 GO:0009626 GO:0009719 GO:0009725 GO:0009751 GO:0009812 GO:0009987 GO:0010033 GO:0010204 GO:0010243 GO:0010498 GO:0012501 GO:0012505 GO:0014070 GO:0016740 GO:0016757 GO:0016758 GO:0018193 GO:0018196 GO:0018279 GO:0019538 GO:0023052 GO:0030163 GO:0030968 GO:0031347 GO:0031349 GO:0033554 GO:0034050 GO:0034620 GO:0034641 GO:0034645 GO:0034976 GO:0035251 GO:0035966 GO:0035967 GO:0036211 GO:0036503 GO:0042221 GO:0042440 GO:0042493 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043413 GO:0044237 GO:0044238 GO:0044248 GO:0044249 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0044281 GO:0044424 GO:0044444 GO:0044464 GO:0045087 GO:0045088 GO:0045089 GO:0046283 GO:0046483 GO:0046527 GO:0046677 GO:0048518 GO:0048583 GO:0048584 GO:0050776 GO:0050778 GO:0050789 GO:0050794 GO:0050896 GO:0051082 GO:0051084 GO:0051603 GO:0051716 GO:0051788 GO:0055086 GO:0065007 GO:0070085 GO:0070887 GO:0071218 GO:0071310 GO:0071704 GO:0071712 GO:0080134 GO:0097359 GO:1901135 GO:1901137 GO:1901360 GO:1901564 GO:1901565 GO:1901566 GO:1901575 GO:1901576 GO:1901698 GO:1901700
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.42

Weight (kDa)

6.09

Isoelectric Point (pI)

79.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 325
AciI CCGC 1 cut(s) 251
AclWI GGATC 3 cut(s) 86, 168, 193
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 1 cut(s) 246
AfiI CCNNNNNNNGG 2 cut(s) 202, 313
AgeI ACCGGT 1 cut(s) 313
AgsI TTSAA 2 cut(s) 270, 298
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
AlwI GGATC 3 cut(s) 86, 168, 193
AoxI GGCC 1 cut(s) 3
AsiGI ACCGGT 1 cut(s) 313
AspS9I GGNCC 1 cut(s) 301
AvaII GGWCC 1 cut(s) 301
BauI CACGAG 1 cut(s) 20
Bme18I GGWCC 1 cut(s) 301
BmgT120I GGNCC 1 cut(s) 301
BmiI GGNNCC 1 cut(s) 12
BmsI GCATC 1 cut(s) 200
BsaBI GATNNNNATC 3 cut(s) 88, 170, 190
BsaJI CCNNGG 3 cut(s) 6, 99, 181
BsaWI WCCGGW 1 cut(s) 313
Bsc4I CCNNNNNNNGG 2 cut(s) 202, 313
Bse118I RCCGGY 1 cut(s) 313
Bse8I GATNNNNATC 3 cut(s) 88, 170, 190
BseDI CCNNGG 3 cut(s) 6, 99, 181
BseGI GGATG 1 cut(s) 191
BseJI GATNNNNATC 3 cut(s) 88, 170, 190
BseLI CCNNNNNNNGG 2 cut(s) 202, 313
Bsh1285I CGRYCG 1 cut(s) 318
BshFI GGCC 1 cut(s) 5
BshTI ACCGGT 1 cut(s) 313
BsiEI CGRYCG 1 cut(s) 318
BsiSI CCGG 1 cut(s) 314
BslI CCNNNNNNNGG 2 cut(s) 202, 313
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
BspACI CCGC 1 cut(s) 251
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 12
BspPI GGATC 3 cut(s) 86, 168, 193
BsrFI RCCGGY 1 cut(s) 313
BssAI RCCGGY 1 cut(s) 313
BssECI CCNNGG 3 cut(s) 6, 99, 181
BssMI GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
BssSI CACGAG 1 cut(s) 20
BssT1I CCWWGG 2 cut(s) 99, 181
Bst2BI CACGAG 1 cut(s) 20
BstC8I GCNNGC 1 cut(s) 280
BstF5I GGATG 1 cut(s) 191
BstKTI GATC 7 cut(s) 49, 81, 92, 131, 163, 174, 188
BstMBI GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
BstMCI CGRYCG 1 cut(s) 318
BstX2I RGATCY 1 cut(s) 185
BstYI RGATCY 1 cut(s) 185
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 1 cut(s) 191
Cac8I GCNNGC 1 cut(s) 280
Cfr10I RCCGGY 1 cut(s) 313
Cfr13I GGNCC 1 cut(s) 301
CspAI ACCGGT 1 cut(s) 313
CviJI RGCY 4 cut(s) 5, 11, 224, 310
CviKI_1 RGCY 4 cut(s) 5, 11, 224, 310
DpnI GATC 7 cut(s) 48, 80, 91, 130, 162, 173, 187
DpnII GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 2 cut(s) 99, 181
Eco47I GGWCC 1 cut(s) 301
Eco57I CTGAAG 1 cut(s) 246
EcoT14I CCWWGG 2 cut(s) 99, 181
ErhI CCWWGG 2 cut(s) 99, 181
FaiI YATR 1 cut(s) 325
FokI GGATG 1 cut(s) 178
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 314
HinfI GANTC 1 cut(s) 230
HpaII CCGG 1 cut(s) 314
Hpy166II GTNNAC 2 cut(s) 72, 154
Hpy188I TCNGA 3 cut(s) 15, 83, 165
Hpy188III TCNNGA 1 cut(s) 270
Hpy8I GTNNAC 2 cut(s) 72, 154
HpyAV CCTTC 1 cut(s) 292
HpyCH4V TGCA 1 cut(s) 191
Kzo9I GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
LmnI GCTCC 3 cut(s) 16, 101, 183
LpnPI CCDG 2 cut(s) 292, 320
LweI GCATC 1 cut(s) 200
MalI GATC 7 cut(s) 48, 80, 91, 130, 162, 173, 187
MboI GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
MboII GAAGA 1 cut(s) 239
MflI RGATCY 1 cut(s) 185
MluCI AATT 3 cut(s) 218, 265, 293
MnlI CCTC 5 cut(s) 19, 49, 101, 131, 283
MspI CCGG 1 cut(s) 314
NdeII GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
NlaIV GGNNCC 1 cut(s) 12
NmeAIII GCCGAG 1 cut(s) 31
PfeI GAWTC 1 cut(s) 230
PinAI ACCGGT 1 cut(s) 313
PsiI TTATAA 1 cut(s) 325
PspN4I GGNNCC 1 cut(s) 12
PspPI GGNCC 1 cut(s) 301
PsuI RGATCY 1 cut(s) 185
Sau3AI GATC 7 cut(s) 46, 78, 89, 128, 160, 171, 185
Sau96I GGNCC 1 cut(s) 301
SetI ASST 1 cut(s) 226
SfaNI GCATC 1 cut(s) 200
SinI GGWCC 1 cut(s) 301
Sse9I AATT 3 cut(s) 218, 265, 293
SsiI CCGC 1 cut(s) 251
StyI CCWWGG 2 cut(s) 99, 181
TaqI TCGA 1 cut(s) 318
TasI AATT 3 cut(s) 218, 265, 293
TfiI GAWTC 1 cut(s) 230
TspDTI ATGAA 1 cut(s) 273
VpaK11BI GGWCC 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.