Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0000640

Physical Location & Seq

Genomic Coordinates Forward (+)

18494743 .. 18496226

Gene Structure 1484 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00097280.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGGGTGTGGATTACTACAAGCTTTTACAGGTTGAGTGGTGCGCCACAGATGATGAATTGAAGAAGGCTTATAGAAAATTGGCGATAAGAAACCCCGCCAATAATAAAGAAGCTGAGACCAAATTCAAGCAGATCTCTGAGGCCTATGAGGTTCTGAGTGATTCCCAGAAAAGAGCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000226 GO:0001578 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005856 GO:0005929 GO:0005930 GO:0006996 GO:0007010 GO:0007017 GO:0008150 GO:0009987 GO:0016043 GO:0022607 GO:0030030 GO:0030031 GO:0031514 GO:0032838 GO:0035082 GO:0036126 GO:0042995 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044085 GO:0044422 GO:0044424 GO:0044430 GO:0044441 GO:0044444 GO:0044446 GO:0044463 GO:0044464 GO:0044782 GO:0060271 GO:0070925 GO:0071840 GO:0097014 GO:0097223 GO:0097224 GO:0097729 GO:0099568 GO:0120025 GO:0120031 GO:0120036 GO:0120038 GO:1904158

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ DnaJ_C

Protein Analysis

59

Amino Acids

6.9

Weight (kDa)

7.81

Isoelectric Point (pI)

28.27

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DnaJ	PF00226	4 - 59	2e-18	DnaJ domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000640)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata	RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora	Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii	Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa	Rorug02G0515900 Rorug06G0038100.1
rosa_samantha	Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana	Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	96
AcsI	RAATTY	1 cut(s)	122
AgsI	TTSAA	2 cut(s)	61, 127
AluBI	AGCT	2 cut(s)	22, 113
AluI	AGCT	2 cut(s)	22, 113
Alw26I	GTCTC	1 cut(s)	110
AoxI	GGCC	1 cut(s)	141
ApoI	RAATTY	1 cut(s)	122
AspLEI	GCGC	1 cut(s)	44
BcoDI	GTCTC	1 cut(s)	110
BglII	AGATCT	1 cut(s)	132
BsaI	GGTCTC	1 cut(s)	110
BseMII	CTCAG	3 cut(s)	105, 129, 146
BshFI	GGCC	1 cut(s)	143
BsmAI	GTCTC	1 cut(s)	110
BsnI	GGCC	1 cut(s)	143
Bso31I	GGTCTC	1 cut(s)	110
Bsp143I	GATC	1 cut(s)	132
BspACI	CCGC	1 cut(s)	96
BspANI	GGCC	1 cut(s)	143
BspCNI	CTCAG	3 cut(s)	106, 130, 147
BspTNI	GGTCTC	1 cut(s)	110
BssMI	GATC	1 cut(s)	132
BstDEI	CTNAG	3 cut(s)	114, 138, 155
BstHHI	GCGC	1 cut(s)	44
BstKTI	GATC	1 cut(s)	135
BstMAI	GTCTC	1 cut(s)	110
BstMBI	GATC	1 cut(s)	132
BstX2I	RGATCY	1 cut(s)	132
BstYI	RGATCY	1 cut(s)	132
BsuRI	GGCC	1 cut(s)	143
CfoI	GCGC	1 cut(s)	44
CviAII	CATG	1 cut(s)	177
CviJI	RGCY	4 cut(s)	22, 68, 113, 143
CviKI_1	RGCY	4 cut(s)	22, 68, 113, 143
DdeI	CTNAG	3 cut(s)	114, 138, 155
DpnI	GATC	1 cut(s)	134
DpnII	GATC	1 cut(s)	132
Eco147I	AGGCCT	1 cut(s)	143
Eco31I	GGTCTC	1 cut(s)	110
FaeI	CATG	1 cut(s)	180
FaiI	YATR	3 cut(s)	72, 147, 178
FatI	CATG	1 cut(s)	176
FauI	CCCGC	1 cut(s)	103
GlaI	GCGC	1 cut(s)	43
HaeIII	GGCC	1 cut(s)	143
HhaI	GCGC	1 cut(s)	44
Hin1II	CATG	1 cut(s)	180
Hin6I	GCGC	1 cut(s)	42
HinP1I	GCGC	1 cut(s)	42
HindIII	AAGCTT	1 cut(s)	20
HinfI	GANTC	1 cut(s)	161
Hpy188I	TCNGA	2 cut(s)	139, 156
HpyAV	CCTTC	1 cut(s)	58
HpyF3I	CTNAG	3 cut(s)	114, 138, 155
Hsp92II	CATG	1 cut(s)	180
HspAI	GCGC	1 cut(s)	42
Kzo9I	GATC	1 cut(s)	132
LpnPI	CCDG	1 cut(s)	14
MalI	GATC	1 cut(s)	134
MboI	GATC	1 cut(s)	132
MboII	GAAGA	1 cut(s)	73
MflI	RGATCY	1 cut(s)	132
MluCI	AATT	3 cut(s)	56, 77, 122
MnlI	CCTC	2 cut(s)	133, 142
NdeII	GATC	1 cut(s)	132
NlaIII	CATG	1 cut(s)	180
PceI	AGGCCT	1 cut(s)	143
PfeI	GAWTC	1 cut(s)	161
PsuI	RGATCY	1 cut(s)	132
Sau3AI	GATC	1 cut(s)	132
SetI	ASST	4 cut(s)	24, 33, 115, 153
SgeI	CNNG	4 cut(s)	31, 41, 107, 139
Sse9I	AATT	3 cut(s)	56, 77, 122
SseBI	AGGCCT	1 cut(s)	143
SsiI	CCGC	1 cut(s)	96
StuI	AGGCCT	1 cut(s)	143
TasI	AATT	3 cut(s)	56, 77, 122
TfiI	GAWTC	1 cut(s)	161
TspDTI	ATGAA	1 cut(s)	69
XapI	RAATTY	1 cut(s)	122

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.