Rroxscaffold_2G00097280

DnaJ homolog subfamily B member

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
18494743 .. 18496226
1484 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00097280.1

Sequence Viewer

Length: 180 bp
ATGGGTGTGGATTACTACAAGCTTTTACAGGTTGAGTGGTGCGCCACAGATGATGAATTGAAGAAGGCTTATAGAAAATTGGCGATAAGAAACCCCGCCAATAATAAAGAAGCTGAGACCAAATTCAAGCAGATCTCTGAGGCCTATGAGGTTCTGAGTGATTCCCAGAAAAGAGCATGA

Protein Analysis

59

Amino Acids

6.9

Weight (kDa)

7.81

Isoelectric Point (pI)

28.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 4 - 59 2e-18 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331021 RchiOBHm_Chr1g0335951 RchiOBHm_Chr1g0338001 RchiOBHm_Chr6g0276241 RchiOBHm_Chr6g0297731 RchiOBHm_Chr7g0188211 RchiOBHm_Chr7g0217921 RchiOBHm_Chr7g0238211
rosa_laevigata RLG00000007457 RLG00000015447 RLG00000019185 RLG00000032916 RLG00000034538
rosa_multiflora Rmu_sc0000923.1_g000008 Rmu_sc0002931.1_g000001 Rmu_sc0006850.1_g000014
rosa_roxburghii Rroxscaffold_1G00021360 Rroxscaffold_1G00022610 Rroxscaffold_1G00022620 Rroxscaffold_1G00025730 Rroxscaffold_1G00029440 Rroxscaffold_1G00029610 Rroxscaffold_1G00032940 Rroxscaffold_1G00034000 Rroxscaffold_2G00087130 Rroxscaffold_2G00093110 Rroxscaffold_2G00097280 Rroxscaffold_2G00121440 Rroxscaffold_3G00225890 Rroxscaffold_3G00238130 Rroxscaffold_3G00241910 Rroxscaffold_3G00267280 Rroxscaffold_4G00295970 Rroxscaffold_4G00299040 Rroxscaffold_4G00303830 Rroxscaffold_4G00305880 Rroxscaffold_5G00335820 Rroxscaffold_5G00343740 Rroxscaffold_5G00346800 Rroxscaffold_5G00348110 Rroxscaffold_5G00371220 Rroxscaffold_5G00383470 Rroxscaffold_5G00387630 Rroxscaffold_6G00388100 Rroxscaffold_6G00395960 Rroxscaffold_6G00397500 Rroxscaffold_6G00405550 Rroxscaffold_7G00195020 Rroxscaffold_7G00217460
rosa_rugosa Rorug02G0515900 Rorug06G0038100.1
rosa_samantha Rh1CG171700 Rh2AG250300 Rh2AG481200 Rh2CG103900 Rh2CG467500 Rh2DG121800 Rh2DG258400 Rh3AG000900 Rh3CG000600 Rh3DG000800 Rh4DG164800 Rh5AG157100 Rh5AG476500 Rh5AG519300 Rh5DG192000 Rh5DG243900 Rh6CG399800 Rh6DG207500 Rh6DG458300 Rh6DG458400 Rh7AG314100 Rh7AG466900 Rh7DG095400
rosa_wichuraiana Rw5G004310 Rw5G049380 Rw6G000590 Rw6G025650

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 96
AcsI RAATTY 1 cut(s) 122
AgsI TTSAA 2 cut(s) 61, 127
AluBI AGCT 2 cut(s) 22, 113
AluI AGCT 2 cut(s) 22, 113
Alw26I GTCTC 1 cut(s) 110
AoxI GGCC 1 cut(s) 141
ApoI RAATTY 1 cut(s) 122
AspLEI GCGC 1 cut(s) 44
BcoDI GTCTC 1 cut(s) 110
BglII AGATCT 1 cut(s) 132
BsaI GGTCTC 1 cut(s) 110
BseMII CTCAG 3 cut(s) 105, 129, 146
BshFI GGCC 1 cut(s) 143
BsmAI GTCTC 1 cut(s) 110
BsnI GGCC 1 cut(s) 143
Bso31I GGTCTC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 132
BspACI CCGC 1 cut(s) 96
BspANI GGCC 1 cut(s) 143
BspCNI CTCAG 3 cut(s) 106, 130, 147
BspTNI GGTCTC 1 cut(s) 110
BssMI GATC 1 cut(s) 132
BstDEI CTNAG 3 cut(s) 114, 138, 155
BstHHI GCGC 1 cut(s) 44
BstKTI GATC 1 cut(s) 135
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 1 cut(s) 132
BstX2I RGATCY 1 cut(s) 132
BstYI RGATCY 1 cut(s) 132
BsuRI GGCC 1 cut(s) 143
CfoI GCGC 1 cut(s) 44
CviAII CATG 1 cut(s) 177
CviJI RGCY 4 cut(s) 22, 68, 113, 143
CviKI_1 RGCY 4 cut(s) 22, 68, 113, 143
DdeI CTNAG 3 cut(s) 114, 138, 155
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
Eco147I AGGCCT 1 cut(s) 143
Eco31I GGTCTC 1 cut(s) 110
FaeI CATG 1 cut(s) 180
FaiI YATR 3 cut(s) 72, 147, 178
FatI CATG 1 cut(s) 176
FauI CCCGC 1 cut(s) 103
GlaI GCGC 1 cut(s) 43
HaeIII GGCC 1 cut(s) 143
HhaI GCGC 1 cut(s) 44
Hin1II CATG 1 cut(s) 180
Hin6I GCGC 1 cut(s) 42
HinP1I GCGC 1 cut(s) 42
HindIII AAGCTT 1 cut(s) 20
HinfI GANTC 1 cut(s) 161
Hpy188I TCNGA 2 cut(s) 139, 156
HpyAV CCTTC 1 cut(s) 58
HpyF3I CTNAG 3 cut(s) 114, 138, 155
Hsp92II CATG 1 cut(s) 180
HspAI GCGC 1 cut(s) 42
Kzo9I GATC 1 cut(s) 132
LpnPI CCDG 1 cut(s) 14
MalI GATC 1 cut(s) 134
MboI GATC 1 cut(s) 132
MboII GAAGA 1 cut(s) 73
MflI RGATCY 1 cut(s) 132
MluCI AATT 3 cut(s) 56, 77, 122
MnlI CCTC 2 cut(s) 133, 142
NdeII GATC 1 cut(s) 132
NlaIII CATG 1 cut(s) 180
PceI AGGCCT 1 cut(s) 143
PfeI GAWTC 1 cut(s) 161
PsuI RGATCY 1 cut(s) 132
Sau3AI GATC 1 cut(s) 132
SetI ASST 4 cut(s) 24, 33, 115, 153
SgeI CNNG 4 cut(s) 31, 41, 107, 139
Sse9I AATT 3 cut(s) 56, 77, 122
SseBI AGGCCT 1 cut(s) 143
SsiI CCGC 1 cut(s) 96
StuI AGGCCT 1 cut(s) 143
TasI AATT 3 cut(s) 56, 77, 122
TfiI GAWTC 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 69
XapI RAATTY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.