Rroxscaffold_4G00314350

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0001119
Physical Location & Seq
Reverse (-)
38344693 .. 38349001
4309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00314350.1

Sequence Viewer

Length: 189 bp
ATGCGGGACCTTAGTCGGAGGCCATCACCGCACCAAAGGTTTCGTAAGGGATATGGTAAGGGTTTGGACTTTGAATCCGTTAATGGTGAAACTATGGTGGTTGATAGTGTAGCAGATGGTCTTGCCAATATGGCTCATTCTCTGGGATTAGGCCTTCATATTCTTCAGGATCCCCCTCAGTCTATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.8

Weight (kDa)

6.82

Isoelectric Point (pI)

57.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 4, 29
AclWI GGATC 2 cut(s) 164, 177
AcuI CTGAAG 1 cut(s) 149
AgsI TTSAA 1 cut(s) 74
AlwI GGATC 2 cut(s) 164, 177
AoxI GGCC 2 cut(s) 20, 151
AspS9I GGNCC 1 cut(s) 7
AsuHPI GGTGA 2 cut(s) 18, 98
AvaII GGWCC 1 cut(s) 7
BamHI GGATCC 1 cut(s) 169
BccI CCATC 2 cut(s) 31, 110
BglI GCCNNNNNGGC 1 cut(s) 131
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmiI GGNNCC 2 cut(s) 8, 171
BoxI GACNNNNGTC 1 cut(s) 12
BshFI GGCC 2 cut(s) 22, 153
BslFI GGGAC 1 cut(s) 20
BsmFI GGGAC 1 cut(s) 20
BsnI GGCC 2 cut(s) 22, 153
Bsp143I GATC 1 cut(s) 169
BspACI CCGC 2 cut(s) 4, 29
BspANI GGCC 2 cut(s) 22, 153
BspLI GGNNCC 2 cut(s) 8, 171
BspPI GGATC 2 cut(s) 164, 177
BssMI GATC 1 cut(s) 169
BstDEI CTNAG 2 cut(s) 11, 177
BstKTI GATC 1 cut(s) 172
BstMBI GATC 1 cut(s) 169
BstMWI GCNNNNNNNGC 2 cut(s) 28, 131
BstPAI GACNNNNGTC 1 cut(s) 12
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
BsuRI GGCC 2 cut(s) 22, 153
Cfr13I GGNCC 1 cut(s) 7
CviJI RGCY 3 cut(s) 22, 134, 153
CviKI_1 RGCY 3 cut(s) 22, 134, 153
DdeI CTNAG 2 cut(s) 11, 177
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
Eco147I AGGCCT 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 149
EcoO109I RGGNCCY 1 cut(s) 7
FaiI YATR 4 cut(s) 54, 95, 131, 159
FaqI GGGAC 1 cut(s) 20
HaeIII GGCC 2 cut(s) 22, 153
HinfI GANTC 1 cut(s) 74
HphI GGTGA 2 cut(s) 18, 98
Hpy188I TCNGA 2 cut(s) 18, 188
Hpy188III TCNNGA 1 cut(s) 167
HpyAV CCTTC 1 cut(s) 164
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 131
HpyF3I CTNAG 2 cut(s) 11, 177
Kzo9I GATC 1 cut(s) 169
LpnPI CCDG 2 cut(s) 128, 152
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MboII GAAGA 1 cut(s) 155
MflI RGATCY 1 cut(s) 169
MnlI CCTC 2 cut(s) 12, 186
MseI TTAA 1 cut(s) 81
MwoI GCNNNNNNNGC 2 cut(s) 28, 131
NdeII GATC 1 cut(s) 169
NlaIV GGNNCC 2 cut(s) 8, 171
PceI AGGCCT 1 cut(s) 153
PfeI GAWTC 1 cut(s) 74
PpuMI RGGWCCY 1 cut(s) 7
PshAI GACNNNNGTC 1 cut(s) 12
Psp5II RGGWCCY 1 cut(s) 7
PspN4I GGNNCC 2 cut(s) 8, 171
PspPI GGNCC 1 cut(s) 7
PspPPI RGGWCCY 1 cut(s) 7
PsuI RGATCY 1 cut(s) 169
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 1 cut(s) 169
Sau96I GGNCC 1 cut(s) 7
SetI ASST 2 cut(s) 12, 41
SgeI CNNG 4 cut(s) 17, 134, 155, 179
SinI GGWCC 1 cut(s) 7
SseBI AGGCCT 1 cut(s) 153
SsiI CCGC 2 cut(s) 4, 29
StuI AGGCCT 1 cut(s) 153
TfiI GAWTC 1 cut(s) 74
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TspDTI ATGAA 1 cut(s) 146
TspGWI ACGGA 1 cut(s) 67
VpaK11BI GGWCC 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.