Rh4DG195300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0001119
Physical Location & Seq
Reverse (-)
38155646 .. 38155958
313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG195300.1

Sequence Viewer

Length: 252 bp
ATGGTGGATGATCGCAAGGGTCGCACTGATGTTAGACAGTGTGGTTCGTTGCAACGTCGAAGAGTTGCCAGCGTTGGGTTCGCTTGGCTAGCTAAGGTGACTGATCTAACCTTGGTTGATGTGATGGTTGCGTTGGCTACAGTGGTGGACTCTTCGATGGCAGCTGGACGGAGGTTGTGGACGATGGAGGTTGGTCTTGGTGGGTGGCTTGGGCCTCCATATGGGTTTGTTTCTTTGGGCTATGGTTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.96

Weight (kDa)

9.61

Isoelectric Point (pI)

36.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 75, 221
AluBI AGCT 2 cut(s) 92, 164
AluI AGCT 2 cut(s) 92, 164
AoxI GGCC 1 cut(s) 212
ApeKI GCWGC 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 212
AsuHPI GGTGA 1 cut(s) 109
AsuNHI GCTAGC 1 cut(s) 88
BbvI GCAGC 1 cut(s) 173
BccI CCATC 3 cut(s) 118, 151, 178
BfaI CTAG 2 cut(s) 89, 250
BfmI CTRYAG 1 cut(s) 138
BisI GCNGC 1 cut(s) 162
BlsI GCNGC 1 cut(s) 163
BmgT120I GGNCC 1 cut(s) 212
BmiI GGNNCC 1 cut(s) 247
BmtI GCTAGC 1 cut(s) 92
Bpu10I CCTNAGC 1 cut(s) 93
BsaJI CCNNGG 1 cut(s) 111
Bsc4I CCNNNNNNNGG 2 cut(s) 75, 221
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 13
BseLI CCNNNNNNNGG 2 cut(s) 75, 221
BseXI GCAGC 1 cut(s) 173
BshFI GGCC 1 cut(s) 214
BslI CCNNNNNNNGG 2 cut(s) 75, 221
BsnI GGCC 1 cut(s) 214
Bsp143I GATC 2 cut(s) 10, 103
BspANI GGCC 1 cut(s) 214
BspLI GGNNCC 1 cut(s) 247
BspOI GCTAGC 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 2 cut(s) 10, 103
BssT1I CCWWGG 1 cut(s) 111
Bst4CI ACNGT 2 cut(s) 39, 142
Bst6I CTCTTC 2 cut(s) 55, 157
BstC8I GCNNGC 2 cut(s) 70, 90
BstDEI CTNAG 1 cut(s) 93
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 2 cut(s) 13, 106
BstMBI GATC 2 cut(s) 10, 103
BstMWI GCNNNNNNNGC 2 cut(s) 21, 89
BstSFI CTRYAG 1 cut(s) 138
BstV1I GCAGC 1 cut(s) 173
BsuRI GGCC 1 cut(s) 214
BtsCI GGATG 1 cut(s) 13
BtsIMutI CAGTG 3 cut(s) 24, 44, 147
Cac8I GCNNGC 2 cut(s) 70, 90
Cfr13I GGNCC 1 cut(s) 212
CviJI RGCY 7 cut(s) 88, 92, 137, 164, 208, 214, 240
CviKI_1 RGCY 7 cut(s) 88, 92, 137, 164, 208, 214, 240
DdeI CTNAG 1 cut(s) 93
DpnI GATC 2 cut(s) 12, 105
DpnII GATC 2 cut(s) 10, 103
Eam1104I CTCTTC 2 cut(s) 55, 157
EarI CTCTTC 2 cut(s) 55, 157
Eco130I CCWWGG 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaiI YATR 3 cut(s) 220, 222, 243
FauNDI CATATG 1 cut(s) 220
Fnu4HI GCNGC 1 cut(s) 162
FokI GGATG 1 cut(s) 20
Fsp4HI GCNGC 1 cut(s) 162
FspBI CTAG 2 cut(s) 89, 250
GluI GCNGC 1 cut(s) 162
HaeIII GGCC 1 cut(s) 214
HinfI GANTC 1 cut(s) 149
HphI GGTGA 1 cut(s) 109
Hpy166II GTNNAC 2 cut(s) 148, 180
Hpy8I GTNNAC 2 cut(s) 148, 180
Hpy99I CGWCG 1 cut(s) 60
HpyCH4III ACNGT 2 cut(s) 39, 142
HpyCH4IV ACGT 1 cut(s) 55
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 2 cut(s) 21, 89
HpyF3I CTNAG 1 cut(s) 93
HpySE526I ACGT 1 cut(s) 55
Kzo9I GATC 2 cut(s) 10, 103
LpnPI CCDG 2 cut(s) 82, 150
Lsp1109I GCAGC 1 cut(s) 173
MaeI CTAG 2 cut(s) 89, 250
MaeII ACGT 1 cut(s) 55
MaeIII GTNAC 1 cut(s) 97
MalI GATC 2 cut(s) 12, 105
MboI GATC 2 cut(s) 10, 103
MboII GAAGA 2 cut(s) 72, 144
MlyI GAGTC 1 cut(s) 143
MnlI CCTC 3 cut(s) 165, 181, 225
MspA1I CMGCKG 1 cut(s) 164
MwoI GCNNNNNNNGC 2 cut(s) 21, 89
NdeI CATATG 1 cut(s) 220
NdeII GATC 2 cut(s) 10, 103
NheI GCTAGC 1 cut(s) 88
NlaIV GGNNCC 1 cut(s) 247
NmuCI GTSAC 1 cut(s) 97
PkrI GCNGC 1 cut(s) 163
PleI GAGTC 1 cut(s) 143
PpsI GAGTC 1 cut(s) 143
PspN4I GGNNCC 1 cut(s) 247
PspPI GGNCC 1 cut(s) 212
PvuII CAGCTG 1 cut(s) 164
SatI GCNGC 1 cut(s) 162
Sau3AI GATC 2 cut(s) 10, 103
Sau96I GGNCC 1 cut(s) 212
SchI GAGTC 1 cut(s) 143
SetI ASST 7 cut(s) 58, 94, 99, 113, 166, 176, 192
SfcI CTRYAG 1 cut(s) 138
SgeI CNNG 8 cut(s) 28, 81, 96, 101, 124, 177, 209, 221
SspMI CTAG 2 cut(s) 89, 250
StyI CCWWGG 1 cut(s) 111
TaaI ACNGT 2 cut(s) 39, 142
TaiI ACGT 1 cut(s) 58
TaqI TCGA 2 cut(s) 58, 155
TscAI CASTG 3 cut(s) 31, 44, 147
TseFI GTSAC 1 cut(s) 97
TseI GCWGC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 97
TspGWI ACGGA 1 cut(s) 184
TspRI CASTG 3 cut(s) 31, 44, 147
XspI CTAG 2 cut(s) 89, 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.