Rh3CG251700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
24541894 .. 24542669
776 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG251700.1

Sequence Viewer

Length: 186 bp
ATGTACTGTGTTGAAGATGAGGTTAGGTTTGGATCTAGGATCGAAACGACTGGGTCAGGGATCGGAGTTGTCCGGTTGGTTTCTCATAGATGGCTGGGTGTATCAGAGATGGTTGGTTTCTCAGAGATCGCAACGTCGACACTGGTGGCTCGCTACAGCGTCGAAGTGTCGCCGGAGTTAGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.65

Weight (kDa)

4.88

Isoelectric Point (pI)

51.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 137
AclWI GGATC 3 cut(s) 40, 47, 68
AfaI GTAC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 179
AgsI TTSAA 1 cut(s) 14
AlwI GGATC 3 cut(s) 40, 47, 68
BccI CCATC 2 cut(s) 84, 103
BfaI CTAG 1 cut(s) 36
BfmI CTRYAG 1 cut(s) 154
BmrI ACTGGG 1 cut(s) 60
BmuI ACTGGG 1 cut(s) 60
BsaWI WCCGGW 1 cut(s) 72
Bsc4I CCNNNNNNNGG 1 cut(s) 179
Bse1I ACTGG 2 cut(s) 55, 147
BseLI CCNNNNNNNGG 1 cut(s) 179
BseMII CTCAG 1 cut(s) 135
BseNI ACTGG 2 cut(s) 55, 147
BseYI CCCAGC 1 cut(s) 94
BsiSI CCGG 2 cut(s) 73, 173
BslI CCNNNNNNNGG 1 cut(s) 179
Bsp143I GATC 4 cut(s) 32, 39, 60, 126
BspCNI CTCAG 1 cut(s) 134
BspPI GGATC 3 cut(s) 40, 47, 68
BsrI ACTGG 2 cut(s) 55, 147
BssMI GATC 4 cut(s) 32, 39, 60, 126
Bst4CI ACNGT 1 cut(s) 8
BstC8I GCNNGC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 121
BstKTI GATC 4 cut(s) 35, 42, 63, 129
BstMBI GATC 4 cut(s) 32, 39, 60, 126
BstSFI CTRYAG 1 cut(s) 154
BstX2I RGATCY 1 cut(s) 32
BstYI RGATCY 1 cut(s) 32
BtsIMutI CAGTG 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 151
CseI GACGC 1 cut(s) 148
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 2 cut(s) 94, 149
CviKI_1 RGCY 2 cut(s) 94, 149
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 121
DpnI GATC 4 cut(s) 34, 41, 62, 128
DpnII GATC 4 cut(s) 32, 39, 60, 126
FaiI YATR 1 cut(s) 87
FblI GTMKAC 1 cut(s) 137
FspBI CTAG 1 cut(s) 36
GsaI CCCAGC 1 cut(s) 98
HapII CCGG 2 cut(s) 73, 173
HgaI GACGC 1 cut(s) 148
HincII GTYRAC 1 cut(s) 138
HindII GTYRAC 1 cut(s) 138
HpaII CCGG 2 cut(s) 73, 173
Hpy166II GTNNAC 1 cut(s) 138
Hpy188I TCNGA 3 cut(s) 65, 106, 124
Hpy8I GTNNAC 1 cut(s) 138
Hpy99I CGWCG 2 cut(s) 139, 164
HpyCH4III ACNGT 1 cut(s) 8
HpyCH4IV ACGT 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 121
HpySE526I ACGT 1 cut(s) 134
Kzo9I GATC 4 cut(s) 32, 39, 60, 126
LpnPI CCDG 5 cut(s) 36, 42, 80, 86, 128
MaeI CTAG 1 cut(s) 36
MaeII ACGT 1 cut(s) 134
MalI GATC 4 cut(s) 34, 41, 62, 128
MboI GATC 4 cut(s) 32, 39, 60, 126
MboII GAAGA 1 cut(s) 26
MflI RGATCY 1 cut(s) 32
MnlI CCTC 1 cut(s) 13
MspI CCGG 2 cut(s) 73, 173
NdeII GATC 4 cut(s) 32, 39, 60, 126
PflFI GACNNNGTC 1 cut(s) 52
PspFI CCCAGC 1 cut(s) 94
PsuI RGATCY 1 cut(s) 32
PsyI GACNNNGTC 1 cut(s) 52
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SalI GTCGAC 1 cut(s) 136
Sau3AI GATC 4 cut(s) 32, 39, 60, 126
SetI ASST 4 cut(s) 24, 29, 137, 184
SfcI CTRYAG 1 cut(s) 154
SgeI CNNG 7 cut(s) 48, 63, 69, 85, 107, 155, 162
SspMI CTAG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 8
TaiI ACGT 1 cut(s) 137
TaqI TCGA 3 cut(s) 42, 137, 162
TatI WGTACW 1 cut(s) 3
TscAI CASTG 1 cut(s) 147
TspRI CASTG 1 cut(s) 147
Tth111I GACNNNGTC 1 cut(s) 52
XmiI GTMKAC 1 cut(s) 137
XspI CTAG 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.