Rh7CG248300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
23342289 .. 23360589
18301 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG248300.1

Sequence Viewer

Length: 252 bp
ATGGTTGTTATTGATTTGGATGACAGATGTTTGGTATTCAAGCCAAATTTTGCTGGTTTTGGATTGAAGAACATGGTGGATGATCGGAATGTTTGCACTGATGTTAGACATGACGGATCGCTGCTACGTCGAAGAGTCGTCAAAGTTGGGTTGGCCTGGTCGGAGTCAGAAGTCTTCTGGCTGCAGGAGGACATCGGTGCTGACGGCTTGGAGCTTGGTGGTGAAACTTCTAACACCCATATCATAATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.3

Weight (kDa)

4.77

Isoelectric Point (pI)

44.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 124
AcsI RAATTY 1 cut(s) 46
AgsI TTSAA 2 cut(s) 40, 67
AjnI CCWGG 1 cut(s) 155
AluBI AGCT 1 cut(s) 214
AluI AGCT 1 cut(s) 214
AlwI GGATC 1 cut(s) 124
AoxI GGCC 1 cut(s) 153
ApeKI GCWGC 2 cut(s) 121, 181
ApoI RAATTY 1 cut(s) 46
AsuHPI GGTGA 1 cut(s) 233
BbsI GAAGAC 1 cut(s) 166
BbvI GCAGC 2 cut(s) 108, 168
BceAI ACGGC 1 cut(s) 220
BciT130I CCWGG 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 182
BisI GCNGC 2 cut(s) 122, 182
BlsI GCNGC 2 cut(s) 123, 183
Bme1390I CCNGG 1 cut(s) 157
BmrFI CCNGG 1 cut(s) 157
BpiI GAAGAC 1 cut(s) 166
BseBI CCWGG 1 cut(s) 157
BseGI GGATG 2 cut(s) 25, 85
BseXI GCAGC 2 cut(s) 108, 168
BshFI GGCC 1 cut(s) 155
BsnI GGCC 1 cut(s) 155
Bsp143I GATC 2 cut(s) 82, 116
BspANI GGCC 1 cut(s) 155
BspMAI CTGCAG 1 cut(s) 186
BspPI GGATC 1 cut(s) 124
BssMI GATC 2 cut(s) 82, 116
Bst2UI CCWGG 1 cut(s) 157
Bst6I CTCTTC 1 cut(s) 127
BstF5I GGATG 2 cut(s) 25, 85
BstKTI GATC 2 cut(s) 85, 119
BstMBI GATC 2 cut(s) 82, 116
BstNI CCWGG 1 cut(s) 157
BstSCI CCNGG 1 cut(s) 155
BstSFI CTRYAG 1 cut(s) 182
BstV1I GCAGC 2 cut(s) 108, 168
BstV2I GAAGAC 1 cut(s) 166
BsuRI GGCC 1 cut(s) 155
BtsCI GGATG 2 cut(s) 25, 85
BtsIMutI CAGTG 1 cut(s) 96
CviAII CATG 2 cut(s) 73, 110
CviJI RGCY 5 cut(s) 43, 155, 181, 207, 214
CviKI_1 RGCY 5 cut(s) 43, 155, 181, 207, 214
DpnI GATC 2 cut(s) 84, 118
DpnII GATC 2 cut(s) 82, 116
Eam1104I CTCTTC 1 cut(s) 127
EarI CTCTTC 1 cut(s) 127
EcoRII CCWGG 1 cut(s) 155
FaeI CATG 2 cut(s) 76, 113
FaiI YATR 4 cut(s) 74, 111, 240, 245
FatI CATG 2 cut(s) 72, 109
Fnu4HI GCNGC 2 cut(s) 122, 182
FokI GGATG 2 cut(s) 32, 92
Fsp4HI GCNGC 2 cut(s) 122, 182
GluI GCNGC 2 cut(s) 122, 182
HaeIII GGCC 1 cut(s) 155
Hin1II CATG 2 cut(s) 76, 113
HinfI GANTC 2 cut(s) 135, 164
HphI GGTGA 1 cut(s) 233
Hpy188I TCNGA 3 cut(s) 87, 163, 169
Hpy99I CGWCG 1 cut(s) 132
HpyCH4IV ACGT 1 cut(s) 127
HpyCH4V TGCA 2 cut(s) 96, 184
HpySE526I ACGT 1 cut(s) 127
Hsp92II CATG 2 cut(s) 76, 113
Kzo9I GATC 2 cut(s) 82, 116
LmnI GCTCC 1 cut(s) 211
LpnPI CCDG 5 cut(s) 39, 142, 163, 169, 170
Lsp1109I GCAGC 2 cut(s) 108, 168
MaeII ACGT 1 cut(s) 127
MalI GATC 2 cut(s) 84, 118
MboI GATC 2 cut(s) 82, 116
MboII GAAGA 3 cut(s) 79, 144, 166
MluCI AATT 1 cut(s) 46
MlyI GAGTC 2 cut(s) 144, 173
MmeI TCCRAC 1 cut(s) 141
MnlI CCTC 1 cut(s) 181
MspR9I CCNGG 1 cut(s) 157
MvaI CCWGG 1 cut(s) 157
NdeII GATC 2 cut(s) 82, 116
NlaIII CATG 2 cut(s) 76, 113
PkrI GCNGC 2 cut(s) 123, 183
PleI GAGTC 2 cut(s) 143, 172
PpsI GAGTC 2 cut(s) 143, 172
Psp6I CCWGG 1 cut(s) 155
PspGI CCWGG 1 cut(s) 155
PstI CTGCAG 1 cut(s) 186
SatI GCNGC 2 cut(s) 122, 182
Sau3AI GATC 2 cut(s) 82, 116
SchI GAGTC 2 cut(s) 144, 173
ScrFI CCNGG 1 cut(s) 157
SetI ASST 2 cut(s) 130, 216
SfcI CTRYAG 1 cut(s) 182
Sse9I AATT 1 cut(s) 46
StyD4I CCNGG 1 cut(s) 155
TaiI ACGT 1 cut(s) 130
TaqI TCGA 1 cut(s) 130
TasI AATT 1 cut(s) 46
TscAI CASTG 1 cut(s) 103
TseI GCWGC 2 cut(s) 121, 181
TspGWI ACGGA 1 cut(s) 129
TspRI CASTG 1 cut(s) 103
XapI RAATTY 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.