Rh4AG197600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0001119
Physical Location & Seq
Reverse (-)
48155166 .. 48155496
331 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG197600.1

Sequence Viewer

Length: 207 bp
ATGGTGGCGTTCTCTACTGGCTGCCAGATCAAGGCACTTTGGTTCTCGGATGTTGGTGGAGCAGGTTGCGTTGGCTATAGTGGTGGACTATTCGATGGCAGCTGGATGGAGGCTGTGGACGATAGAGGTTTGAGCATGATTCCTCTTTTCAAGGCGGAGAGCGTGACTATGCCGATTGTGGAGTCCGCTATTGCTGAGGGTAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.08

Weight (kDa)

4.07

Isoelectric Point (pI)

13.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 53
AciI CCGC 2 cut(s) 155, 186
AfiI CCNNNNNNNGG 1 cut(s) 31
AgsI TTSAA 1 cut(s) 151
AluBI AGCT 1 cut(s) 102
AluI AGCT 1 cut(s) 102
ApeKI GCWGC 2 cut(s) 21, 99
BbvCI CCTCAGC 1 cut(s) 195
BbvI GCAGC 2 cut(s) 8, 111
BccI CCATC 2 cut(s) 89, 100
BfmI CTRYAG 1 cut(s) 76
BfuAI ACCTGC 1 cut(s) 53
BisI GCNGC 2 cut(s) 22, 100
BlsI GCNGC 2 cut(s) 23, 101
Bpu10I CCTNAGC 1 cut(s) 195
Bsc4I CCNNNNNNNGG 1 cut(s) 31
Bse1I ACTGG 1 cut(s) 22
BseGI GGATG 2 cut(s) 55, 111
BseLI CCNNNNNNNGG 1 cut(s) 31
BseMII CTCAG 1 cut(s) 186
BseNI ACTGG 1 cut(s) 22
BseXI GCAGC 2 cut(s) 8, 111
BslI CCNNNNNNNGG 1 cut(s) 31
Bsp143I GATC 1 cut(s) 27
BspACI CCGC 2 cut(s) 155, 186
BspCNI CTCAG 1 cut(s) 187
BspMI ACCTGC 1 cut(s) 53
BsrI ACTGG 1 cut(s) 22
BssMI GATC 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 195
BstF5I GGATG 2 cut(s) 55, 111
BstKTI GATC 1 cut(s) 30
BstMBI GATC 1 cut(s) 27
BstSFI CTRYAG 1 cut(s) 76
BstV1I GCAGC 2 cut(s) 8, 111
BtsCI GGATG 2 cut(s) 55, 111
BveI ACCTGC 1 cut(s) 53
CviAII CATG 1 cut(s) 136
CviJI RGCY 4 cut(s) 21, 75, 102, 113
CviKI_1 RGCY 4 cut(s) 21, 75, 102, 113
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 29
DpnII GATC 1 cut(s) 27
EciI GGCGGA 1 cut(s) 170
FaeI CATG 1 cut(s) 139
FaiI YATR 3 cut(s) 78, 137, 170
FatI CATG 1 cut(s) 135
Fnu4HI GCNGC 2 cut(s) 22, 100
FokI GGATG 2 cut(s) 62, 118
Fsp4HI GCNGC 2 cut(s) 22, 100
GluI GCNGC 2 cut(s) 22, 100
Hin1II CATG 1 cut(s) 139
HinfI GANTC 2 cut(s) 139, 182
Hpy166II GTNNAC 2 cut(s) 86, 118
Hpy188I TCNGA 1 cut(s) 49
Hpy8I GTNNAC 2 cut(s) 86, 118
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 1 cut(s) 27
LmnI GCTCC 1 cut(s) 59
LpnPI CCDG 4 cut(s) 3, 38, 48, 88
Lsp1109I GCAGC 2 cut(s) 8, 111
MaeIII GTNAC 2 cut(s) 163, 200
MalI GATC 1 cut(s) 29
MboI GATC 1 cut(s) 27
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 4 cut(s) 103, 119, 153, 190
MspA1I CMGCKG 1 cut(s) 102
NdeII GATC 1 cut(s) 27
NlaIII CATG 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 163
PfeI GAWTC 1 cut(s) 139
PkrI GCNGC 2 cut(s) 23, 101
PleI GAGTC 1 cut(s) 190
PpsI GAGTC 1 cut(s) 190
PvuII CAGCTG 1 cut(s) 102
SatI GCNGC 2 cut(s) 22, 100
Sau3AI GATC 1 cut(s) 27
SchI GAGTC 1 cut(s) 191
SetI ASST 3 cut(s) 67, 104, 130
SfcI CTRYAG 1 cut(s) 76
SgeI CNNG 9 cut(s) 30, 37, 43, 58, 75, 115, 148, 163, 175
SsiI CCGC 2 cut(s) 155, 186
TaqI TCGA 1 cut(s) 93
TfiI GAWTC 1 cut(s) 139
TseFI GTSAC 1 cut(s) 163
TseI GCWGC 2 cut(s) 21, 99
Tsp45I GTSAC 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.