Rh5AG019700

stigma-specific Stig1 family protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
1407693 .. 1407920
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG019700.1

Sequence Viewer

Length: 228 bp
ATGTTGATGGCTTTAGCCGTTACTCTTTCTGCAACACTAGTCGAAGAAGAACTACTTTCCGACAAGGGAACCGAGGCTACAAATGATCACGAAACCTTTGATGGTGATCGTCCAATGGATGCCAAAAGCCAAGGGAAAACCTCTCTGAGGGGAACAAGTAGCGTCTTCCTTGGTTCTACTTCTAGGGCAGTGACAACTGACAACATCAACATGCGACAAAAACTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.09

Weight (kDa)

4.9

Isoelectric Point (pI)

32.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000301)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G11925
fragaria_vesca FvH4_2g01120 FvH4_3g01640 FvH4_3g01660 FvH4_3g01670 FvH4_3g01672 FvH4_3g18030
malus_domestica MD05G1350300.v1.1 MD05G1350400.v1.1 MD05G1350500.v1.1 MD07G1060200.v1.1 MD07G1060300.v1.1 MD10G1325000.v1.1 MD10G1325100.v1.1 MD10G1325200.v1.1 MD10G1325300.v1.1 MD11G1212900.v1.1
prunus_persica Prupe.4G016900_v2.0.a1 Prupe.4G017000_v2.0.a1 Prupe.4G017100_v2.0.a1 Prupe.4G017200_v2.0.a1 Prupe.4G020300_v2.0.a1 Prupe.4G218500_v2.0.a1 Prupe.4G218600_v2.0.a1
pyrus_communis pycom05g31780 pycom05g31790
rosa_chinensis RchiOBHm_Chr4g0430681 RchiOBHm_Chr4g0430691 RchiOBHm_Chr5g0002431 RchiOBHm_Chr5g0002441 RchiOBHm_Chr5g0002451 RchiOBHm_Chr5g0002461 RchiOBHm_Chr5g0002511 RchiOBHm_Chr5g0002521 RchiOBHm_Chr5g0030071 RchiOBHm_Chr5g0040841
rosa_laevigata RLG00000006955 RLG00000006956 RLG00000031032 RLG00000031033 RLG00000031035 RLG00000031036
rosa_multiflora Rmu_co8168770.1_g000001 Rmu_co8419035.1_g000001 Rmu_co8421345.1_g000001 Rmu_sc0000131.1_g000010 Rmu_sc0000131.1_g000011 Rmu_sc0000140.1_g000002 Rmu_sc0001717.1_g000006 Rmu_sc0001717.1_g000007 Rmu_sc0001717.1_g000008 Rmu_sc0001717.1_g000012 Rmu_sc0003568.1_g000001 Rmu_sc0013444.1_g000002 Rmu_sc0039536.1_g000001
rosa_roxburghii Rroxscaffold_1G00039860 Rroxscaffold_1G00049920 Rroxscaffold_1G00049960 Rroxscaffold_1G00073380 Rroxscaffold_1G00073390 Rroxscaffold_1G00073410 Rroxscaffold_1G00073420 Rroxscaffold_5G00372420 Rroxscaffold_5G00372430
rosa_rugosa Rorug04G0245100 Rorug04G0245200 Rorug04G0396600 Rorug04G0396700 Rorug04G0396700 Rorug04G0396700 Rorug04G0396700 Rorug05G0116800 Rorug05G0188100 Rorug05G0220100
rosa_samantha Rh4BG308400 Rh4BG308500 Rh4BG308800 Rh4BG308900 Rh4BG309100 Rh4BG309200 Rh4CG325600 Rh4CG325700 Rh4DG306000 Rh4DG306100 Rh5AG019100 Rh5AG019200 Rh5AG019300 Rh5AG019600 Rh5AG019700 Rh5AG020000 Rh5BG022000 Rh5BG022100 Rh5BG022300 Rh5BG022400 Rh5BG022700 Rh5CG021000 Rh5CG021100 Rh5CG021200 Rh5CG021500 Rh5CG021600 Rh5CG022000 Rh5CG232500 Rh5CG310700 Rh5DG020100 Rh5DG020300 Rh5DG020400 Rh5DG020600 Rh5DG020800 Rh5DG021100 Rh5DG213100 Rh5DG286900
rosa_wichuraiana Rw4G026160 Rw4G026170 Rw5G001790 Rw5G001800 Rw5G001810 Rw5G001820 Rw5G001840 Rw5G019110 Rw5G025720

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 147
AhlI ACTAGT 1 cut(s) 37
AsuHPI GGTGA 1 cut(s) 116
BarI GAAGNNNNNNTAC 2 cut(s) 36, 68
BbsI GAAGAC 1 cut(s) 157
BccI CCATC 1 cut(s) 95
BceAI ACGGC 1 cut(s) 2
BclI TGATCA 1 cut(s) 85
BcuI ACTAGT 1 cut(s) 37
BfaI CTAG 2 cut(s) 38, 183
BmiI GGNNCC 1 cut(s) 70
BmsI GCATC 1 cut(s) 109
BpiI GAAGAC 1 cut(s) 157
BsaBI GATNNNNATC 1 cut(s) 105
BsaJI CCNNGG 3 cut(s) 72, 130, 169
Bsc4I CCNNNNNNNGG 1 cut(s) 147
Bse8I GATNNNNATC 1 cut(s) 105
BseDI CCNNGG 3 cut(s) 72, 130, 169
BseGI GGATG 1 cut(s) 124
BseJI GATNNNNATC 1 cut(s) 105
BseLI CCNNNNNNNGG 1 cut(s) 147
BseMII CTCAG 1 cut(s) 137
BslI CCNNNNNNNGG 1 cut(s) 147
Bsp143I GATC 2 cut(s) 85, 106
BspCNI CTCAG 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 70
BssECI CCNNGG 3 cut(s) 72, 130, 169
BssMI GATC 2 cut(s) 85, 106
BssT1I CCWWGG 2 cut(s) 130, 169
BstDEI CTNAG 1 cut(s) 146
BstENI CCTNNNNNAGG 1 cut(s) 145
BstF5I GGATG 1 cut(s) 124
BstKTI GATC 2 cut(s) 88, 109
BstMBI GATC 2 cut(s) 85, 106
BstNSI RCATGY 1 cut(s) 214
BstV2I GAAGAC 1 cut(s) 157
BtsCI GGATG 1 cut(s) 124
BtsI GCAGTG 1 cut(s) 195
BtsIMutI CAGTG 1 cut(s) 195
CseI GACGC 1 cut(s) 151
CviAII CATG 1 cut(s) 211
CviJI RGCY 4 cut(s) 11, 17, 77, 129
CviKI_1 RGCY 4 cut(s) 11, 17, 77, 129
DdeI CTNAG 1 cut(s) 146
DpnI GATC 2 cut(s) 87, 108
DpnII GATC 2 cut(s) 85, 106
Eco130I CCWWGG 2 cut(s) 130, 169
EcoNI CCTNNNNNAGG 1 cut(s) 145
EcoT14I CCWWGG 2 cut(s) 130, 169
ErhI CCWWGG 2 cut(s) 130, 169
FaeI CATG 1 cut(s) 214
FaiI YATR 1 cut(s) 212
FalI AAGNNNNNCTT 2 cut(s) 39, 71
FatI CATG 1 cut(s) 210
FbaI TGATCA 1 cut(s) 85
FokI GGATG 1 cut(s) 131
FspBI CTAG 2 cut(s) 38, 183
HgaI GACGC 1 cut(s) 151
Hin1II CATG 1 cut(s) 214
HphI GGTGA 1 cut(s) 116
Hpy188I TCNGA 2 cut(s) 61, 147
Hpy188III TCNNGA 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 146
Hsp92II CATG 1 cut(s) 214
Ksp22I TGATCA 1 cut(s) 85
Kzo9I GATC 2 cut(s) 85, 106
LweI GCATC 1 cut(s) 109
MaeI CTAG 2 cut(s) 38, 183
MaeIII GTNAC 2 cut(s) 19, 190
MalI GATC 2 cut(s) 87, 108
MboI GATC 2 cut(s) 85, 106
MboII GAAGA 3 cut(s) 56, 59, 157
MmeI TCCRAC 1 cut(s) 84
MnlI CCTC 3 cut(s) 67, 141, 151
MslI CAYNNNNRTG 1 cut(s) 209
NdeII GATC 2 cut(s) 85, 106
NlaIII CATG 1 cut(s) 214
NlaIV GGNNCC 1 cut(s) 70
NmuCI GTSAC 1 cut(s) 190
NspI RCATGY 1 cut(s) 214
PspN4I GGNNCC 1 cut(s) 70
PsrI GAACNNNNNNTAC 2 cut(s) 61, 93
RseI CAYNNNNRTG 1 cut(s) 209
Sau3AI GATC 2 cut(s) 85, 106
SetI ASST 2 cut(s) 98, 143
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 9 cut(s) 50, 76, 85, 101, 143, 168, 182, 195, 223
SmiMI CAYNNNNRTG 1 cut(s) 209
SpeI ACTAGT 1 cut(s) 37
SspMI CTAG 2 cut(s) 38, 183
StyI CCWWGG 2 cut(s) 130, 169
TaqI TCGA 1 cut(s) 42
TscAI CASTG 1 cut(s) 195
TseFI GTSAC 1 cut(s) 190
Tsp45I GTSAC 1 cut(s) 190
TspRI CASTG 1 cut(s) 195
XagI CCTNNNNNAGG 1 cut(s) 145
XceI RCATGY 1 cut(s) 214
XspI CTAG 2 cut(s) 38, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.