pycom14g13310

Belongs to the glycosyl hydrolase 1 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
16254151 .. 16254465
315 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g13310.1

Sequence Viewer

Length: 315 bp
ATGGTGTTCTTATTTAGGTTCATGGAACCATTAGTATATGGATCTTATCCAAAGAGTATGAGACGATTGGTCAAGGACAGGCTACCACATTTCACTGAGAAAGAGAAGAAGATGATCACGGGATCCTTAGATTTTGTCGGCATCAACTATTACAGCACGAGATATGGTAGAAACAACCCAGCAGATCCACAAACACCAATCTCCTATAGCAATGATCCTTTAGCTTTGGCGTCGATTACTAGTAAACTTCATAATATCTCACCATTACTTCTTTTCTGTGTGCGCACATGTGTTTTTGTGTCAATAAGTCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.0

Weight (kDa)

9.74

Isoelectric Point (pI)

31.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_1 PF00232 7 - 64 7.7e-12 Glycosyl hydrolase family 1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000392)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G25630 AT2G44450 AT2G44450 AT3G60130 AT3G60130 AT3G60130 AT5G42260 AT5G44640
fragaria_vesca FvH4_5g07160 FvH4_5g07180 FvH4_5g07811 FvH4_5g07831 FvH4_5g07831 FvH4_5g07832 FvH4_6g19950 FvH4_6g19950 FvH4_6g19950
malus_domestica MD01G1120900.v1.1 MD06G1144600.v1.1 MD06G1144800.v1.1 MD06G1145700.v1.1 MD06G1146100.v1.1 MD06G1147000.v1.1 MD08G1072600.v1.1 MD08G1142300.v1.1 MD08G1191100.v1.1 MD14G1159400.v1.1 MD14G1160300.v1.1 MD14G1160600.v1.1 MD14G1160700.v1.1 MD14G1161400.v1.1
prunus_persica Prupe.1G525400_v2.0.a1 Prupe.1G583900_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G156500_v2.0.a1
pyrus_communis pycom06g13390 pycom06g13520 pycom06g13560 pycom06g13640 pycom08g12030 pycom14g13310 pycom14g13430
rosa_chinensis RchiOBHm_Chr3g0475401 RchiOBHm_Chr7g0190551 RchiOBHm_Chr7g0190631 RchiOBHm_Chr7g0190641 RchiOBHm_Chr7g0191241 RchiOBHm_Chr7g0191251 RchiOBHm_Chr7g0191261 RchiOBHm_Chr7g0202591
rosa_laevigata RLG00000004507 RLG00000004508 RLG00000004516 RLG00000023846 RLG00000035079
rosa_multiflora Rmu_co8005672.1_g000001 Rmu_co8018538.1_g000001 Rmu_sc0000526.1_g000002 Rmu_sc0001786.1_g000011 Rmu_sc0006709.1_g000007 Rmu_sc0006709.1_g000008 Rmu_sc0016637.1_g000004
rosa_roxburghii Rroxscaffold_1G00018560 Rroxscaffold_1G00024050 Rroxscaffold_3G00264440 Rroxscaffold_3G00264450 Rroxscaffold_4G00306640 Rroxscaffold_6G00406340
rosa_rugosa Rorug03G0295600 Rorug05G0298500 Rorug06G0072900 Rorug06G0505100 Rorug06G0505800 Rorug06G0505900 Rorug06G0506000
rosa_samantha Rh1CG344200 Rh2AG107900 Rh3AG198700 Rh3CG223000 Rh5AG369500 Rh5BG469700 Rh5BG469800 Rh5DG483000 Rh7AG111700 Rh7AG112400 Rh7AG112500 Rh7AG112600 Rh7CG116400 Rh7CG117400 Rh7CG117500 Rh7CG117600 Rh7CG122100 Rh7CG122200 Rh7DG115600 Rh7DG116400 Rh7DG116500
rosa_wichuraiana Rw3G018030 Rw7G009740 Rw7G009810 Rw7G009820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 284
AclWI GGATC 5 cut(s) 49, 117, 130, 179, 209
AcyI GRCGYC 1 cut(s) 230
AflIII ACRYGT 1 cut(s) 287
AhdI GACNNNNNGTC 1 cut(s) 68
AhlI ACTAGT 1 cut(s) 239
AluBI AGCT 1 cut(s) 224
AluI AGCT 1 cut(s) 224
Alw26I GTCTC 1 cut(s) 55
AlwI GGATC 5 cut(s) 49, 117, 130, 179, 209
AspLEI GCGC 1 cut(s) 285
AsuHPI GGTGA 1 cut(s) 252
BamHI GGATCC 1 cut(s) 122
BauI CACGAG 1 cut(s) 157
BclI TGATCA 1 cut(s) 114
BcoDI GTCTC 1 cut(s) 55
BcuI ACTAGT 1 cut(s) 239
BfaI CTAG 1 cut(s) 240
BfmI CTRYAG 1 cut(s) 205
BmeRI GACNNNNNGTC 1 cut(s) 68
BmiI GGNNCC 2 cut(s) 27, 124
BmsI GCATC 1 cut(s) 150
BsaHI GRCGYC 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 217
BseMI GCAATG 1 cut(s) 217
BseMII CTCAG 1 cut(s) 87
BseYI CCCAGC 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 55
BsmBI CGTCTC 1 cut(s) 55
Bsp143I GATC 5 cut(s) 41, 114, 122, 184, 214
BspCNI CTCAG 1 cut(s) 88
BspLI GGNNCC 2 cut(s) 27, 124
BspPI GGATC 5 cut(s) 49, 117, 130, 179, 209
BsrDI GCAATG 1 cut(s) 217
BssMI GATC 5 cut(s) 41, 114, 122, 184, 214
BssNI GRCGYC 1 cut(s) 230
BssSI CACGAG 1 cut(s) 157
Bst2BI CACGAG 1 cut(s) 157
BstACI GRCGYC 1 cut(s) 230
BstDEI CTNAG 2 cut(s) 96, 127
BstHHI GCGC 1 cut(s) 285
BstKTI GATC 5 cut(s) 44, 117, 125, 187, 217
BstMAI GTCTC 1 cut(s) 55
BstMBI GATC 5 cut(s) 41, 114, 122, 184, 214
BstNSI RCATGY 1 cut(s) 291
BstSFI CTRYAG 1 cut(s) 205
BstX2I RGATCY 3 cut(s) 41, 122, 184
BstYI RGATCY 3 cut(s) 41, 122, 184
BtsIMutI CAGTG 1 cut(s) 93
CfoI GCGC 1 cut(s) 285
CseI GACGC 1 cut(s) 219
CviAII CATG 2 cut(s) 22, 288
CviJI RGCY 2 cut(s) 82, 224
CviKI_1 RGCY 2 cut(s) 82, 224
DdeI CTNAG 2 cut(s) 96, 127
DpnI GATC 5 cut(s) 43, 116, 124, 186, 216
DpnII GATC 5 cut(s) 41, 114, 122, 184, 214
DriI GACNNNNNGTC 1 cut(s) 68
Eam1105I GACNNNNNGTC 1 cut(s) 68
Esp3I CGTCTC 1 cut(s) 55
FaeI CATG 2 cut(s) 25, 291
FaiI YATR 8 cut(s) 23, 37, 39, 59, 165, 207, 252, 289
FatI CATG 2 cut(s) 21, 287
FbaI TGATCA 1 cut(s) 114
FspAI RTGCGCAY 1 cut(s) 284
FspBI CTAG 1 cut(s) 240
FspI TGCGCA 1 cut(s) 284
GlaI GCGC 1 cut(s) 284
GsaI CCCAGC 1 cut(s) 182
HgaI GACGC 1 cut(s) 219
HhaI GCGC 1 cut(s) 285
Hin1I GRCGYC 1 cut(s) 230
Hin1II CATG 2 cut(s) 25, 291
Hin6I GCGC 1 cut(s) 283
HinP1I GCGC 1 cut(s) 283
HphI GGTGA 1 cut(s) 252
Hpy166II GTNNAC 1 cut(s) 245
Hpy8I GTNNAC 1 cut(s) 245
Hpy99I CGWCG 1 cut(s) 235
HpyF3I CTNAG 2 cut(s) 96, 127
Hsp92I GRCGYC 1 cut(s) 230
Hsp92II CATG 2 cut(s) 25, 291
HspAI GCGC 1 cut(s) 283
Ksp22I TGATCA 1 cut(s) 114
Kzo9I GATC 5 cut(s) 41, 114, 122, 184, 214
LpnPI CCDG 2 cut(s) 64, 192
LweI GCATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 240
MalI GATC 5 cut(s) 43, 116, 124, 186, 216
MboI GATC 5 cut(s) 41, 114, 122, 184, 214
MboII GAAGA 2 cut(s) 118, 121
MflI RGATCY 3 cut(s) 41, 122, 184
NdeII GATC 5 cut(s) 41, 114, 122, 184, 214
NlaIII CATG 2 cut(s) 25, 291
NlaIV GGNNCC 2 cut(s) 27, 124
NsbI TGCGCA 1 cut(s) 284
NspI RCATGY 1 cut(s) 291
PciI ACATGT 1 cut(s) 287
PscI ACATGT 1 cut(s) 287
PspFI CCCAGC 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 27, 124
PsuI RGATCY 3 cut(s) 41, 122, 184
Sau3AI GATC 5 cut(s) 41, 114, 122, 184, 214
SetI ASST 2 cut(s) 20, 226
SfaNI GCATC 1 cut(s) 150
SfcI CTRYAG 1 cut(s) 205
SpeI ACTAGT 1 cut(s) 239
SspMI CTAG 1 cut(s) 240
TaqI TCGA 2 cut(s) 233, 310
TscAI CASTG 1 cut(s) 100
TspDTI ATGAA 2 cut(s) 10, 239
TspRI CASTG 1 cut(s) 100
XceI RCATGY 1 cut(s) 291
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.