Rmu_sc0016637.1_g000004

Belongs to the glycosyl hydrolase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016637.1
OG0000392
Physical Location & Seq
Forward (+)
16034 .. 17455
1422 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016637.1_g000004.1.cds

Sequence Viewer

Length: 573 bp
atgggctatgatcttggggttgctccaccaggcaggtgttccataccaggtggtcatttccattattgcacagctggaaattcatctactgaaccttacattgtggttcataaccttctccttgcccatgccactgttgttaagctctatagagaaaagtttcaagctgatggtagcatgttcatcttgtcttatccacaaggtctcaagaaacttttgaagttcatgaagcgaaaataccagagccctaagatctacatttccgaaaatggaattacagaggcaaaggacgataagcgtggacttgatgtagcactgaaggatccacatagaattgaatgtattcttcggcatttgtacatgatcaagcaggccataaagaagggtgtgaacgtcaaaggatatttccactgggctctttttgacgattttgagtggggggaaggctatatcccaaggtacgggctttattatgtcgactacaaggacaatctcaagcgcattcctaaagaatctgcaaagtggctccctaaattcctaaaaggcgaagatgcgatacatgtcaaagcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00460 ko00500 ko00940 ko01100 ko01110 map00460 map00500 map00940 map01100 map01110
Pfam Domains
Protein Families
Glyco_hydro_1

Protein Analysis

190

Amino Acids

21.89

Weight (kDa)

9.37

Isoelectric Point (pI)

34.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000392)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G25630 AT2G44450 AT2G44450 AT3G60130 AT3G60130 AT3G60130 AT5G42260 AT5G44640
fragaria_vesca FvH4_5g07160 FvH4_5g07180 FvH4_5g07811 FvH4_5g07831 FvH4_5g07831 FvH4_5g07832 FvH4_6g19950 FvH4_6g19950 FvH4_6g19950
malus_domestica MD01G1120900.v1.1 MD06G1144600.v1.1 MD06G1144800.v1.1 MD06G1145700.v1.1 MD06G1146100.v1.1 MD06G1147000.v1.1 MD08G1072600.v1.1 MD08G1142300.v1.1 MD08G1191100.v1.1 MD14G1159400.v1.1 MD14G1160300.v1.1 MD14G1160600.v1.1 MD14G1160700.v1.1 MD14G1161400.v1.1
prunus_persica Prupe.1G525400_v2.0.a1 Prupe.1G583900_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G153200_v2.0.a1 Prupe.5G156500_v2.0.a1
pyrus_communis pycom06g13390 pycom06g13520 pycom06g13560 pycom06g13640 pycom08g12030 pycom14g13310 pycom14g13430
rosa_chinensis RchiOBHm_Chr3g0475401 RchiOBHm_Chr7g0190551 RchiOBHm_Chr7g0190631 RchiOBHm_Chr7g0190641 RchiOBHm_Chr7g0191241 RchiOBHm_Chr7g0191251 RchiOBHm_Chr7g0191261 RchiOBHm_Chr7g0202591
rosa_laevigata RLG00000004507 RLG00000004508 RLG00000004516 RLG00000023846 RLG00000035079
rosa_multiflora Rmu_co8005672.1_g000001 Rmu_co8018538.1_g000001 Rmu_sc0000526.1_g000002 Rmu_sc0001786.1_g000011 Rmu_sc0006709.1_g000007 Rmu_sc0006709.1_g000008 Rmu_sc0016637.1_g000004
rosa_roxburghii Rroxscaffold_1G00018560 Rroxscaffold_1G00024050 Rroxscaffold_3G00264440 Rroxscaffold_3G00264450 Rroxscaffold_4G00306640 Rroxscaffold_6G00406340
rosa_rugosa Rorug03G0295600 Rorug05G0298500 Rorug06G0072900 Rorug06G0505100 Rorug06G0505800 Rorug06G0505900 Rorug06G0506000
rosa_samantha Rh1CG344200 Rh2AG107900 Rh3AG198700 Rh3CG223000 Rh5AG369500 Rh5BG469700 Rh5BG469800 Rh5DG483000 Rh7AG111700 Rh7AG112400 Rh7AG112500 Rh7AG112600 Rh7CG116400 Rh7CG117400 Rh7CG117500 Rh7CG117600 Rh7CG122100 Rh7CG122200 Rh7DG115600 Rh7DG116400 Rh7DG116500
rosa_wichuraiana Rw3G018030 Rw7G009740 Rw7G009810 Rw7G009820

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 24
Acc36I ACCTGC 1 cut(s) 24
AccI GTMKAC 1 cut(s) 477
AclWI GGATC 2 cut(s) 317, 330
AcsI RAATTY 2 cut(s) 79, 533
AcuI CTGAAG 1 cut(s) 338
AfaI GTAC 2 cut(s) 359, 461
AfiI CCNNNNNNNGG 1 cut(s) 461
AflIII ACRYGT 1 cut(s) 559
AgsI TTSAA 3 cut(s) 164, 220, 338
AjnI CCWGG 2 cut(s) 28, 46
AluBI AGCT 4 cut(s) 74, 145, 167, 569
AluI AGCT 4 cut(s) 74, 145, 167, 569
Alw26I GTCTC 1 cut(s) 209
AlwI GGATC 2 cut(s) 317, 330
AoxI GGCC 1 cut(s) 372
ApoI RAATTY 2 cut(s) 79, 533
Asp700I GAANNNNTTC 2 cut(s) 159, 342
AspLEI GCGC 1 cut(s) 501
BamHI GGATCC 1 cut(s) 322
BanII GRGCYC 2 cut(s) 248, 418
BarI GAAGNNNNNNTAC 4 cut(s) 221, 253, 540, 572
BccI CCATC 1 cut(s) 164
BciT130I CCWGG 2 cut(s) 30, 48
BclI TGATCA 1 cut(s) 363
BcoDI GTCTC 1 cut(s) 209
BfmI CTRYAG 1 cut(s) 148
BfuAI ACCTGC 1 cut(s) 24
BglII AGATCT 1 cut(s) 252
Bme1390I CCNGG 2 cut(s) 30, 48
BmiI GGNNCC 2 cut(s) 324, 527
BmrFI CCNGG 2 cut(s) 30, 48
BmrI ACTGGG 1 cut(s) 421
BmsI GCATC 1 cut(s) 541
BmuI ACTGGG 1 cut(s) 421
BpuEI CTTGAG 2 cut(s) 191, 479
BsaI GGTCTC 1 cut(s) 209
BsaJI CCNNGG 1 cut(s) 455
Bsc4I CCNNNNNNNGG 1 cut(s) 461
Bse1I ACTGG 1 cut(s) 416
BseBI CCWGG 2 cut(s) 30, 48
BseDI CCNNGG 1 cut(s) 455
BseLI CCNNNNNNNGG 1 cut(s) 461
BseNI ACTGG 1 cut(s) 416
BshFI GGCC 1 cut(s) 374
BslI CCNNNNNNNGG 1 cut(s) 461
BsmAI GTCTC 1 cut(s) 209
BsmI GAATGC 1 cut(s) 501
BsnI GGCC 1 cut(s) 374
Bso31I GGTCTC 1 cut(s) 209
Bsp1286I GDGCHC 2 cut(s) 248, 418
Bsp1407I TGTACA 1 cut(s) 357
Bsp143I GATC 4 cut(s) 10, 252, 322, 363
BspANI GGCC 1 cut(s) 374
BspHI TCATGA 1 cut(s) 225
BspLI GGNNCC 2 cut(s) 324, 527
BspMI ACCTGC 1 cut(s) 24
BspPI GGATC 2 cut(s) 317, 330
BspTNI GGTCTC 1 cut(s) 209
BsrGI TGTACA 1 cut(s) 357
BsrI ACTGG 1 cut(s) 416
BssECI CCNNGG 1 cut(s) 455
BssMI GATC 4 cut(s) 10, 252, 322, 363
BssT1I CCWWGG 1 cut(s) 455
Bst2UI CCWGG 2 cut(s) 30, 48
Bst4CI ACNGT 1 cut(s) 136
BstAUI TGTACA 1 cut(s) 357
BstC8I GCNNGC 1 cut(s) 372
BstDEI CTNAG 2 cut(s) 249, 570
BstHHI GCGC 1 cut(s) 501
BstKTI GATC 4 cut(s) 13, 255, 325, 366
BstMAI GTCTC 1 cut(s) 209
BstMBI GATC 4 cut(s) 10, 252, 322, 363
BstNI CCWGG 2 cut(s) 30, 48
BstNSI RCATGY 2 cut(s) 181, 563
BstSCI CCNGG 2 cut(s) 28, 46
BstSFI CTRYAG 1 cut(s) 148
BstX2I RGATCY 2 cut(s) 252, 322
BstYI RGATCY 2 cut(s) 252, 322
BsuRI GGCC 1 cut(s) 374
BtsIMutI CAGTG 3 cut(s) 132, 314, 409
BveI ACCTGC 1 cut(s) 24
Cac8I GCNNGC 1 cut(s) 372
CciI TCATGA 1 cut(s) 225
CfoI GCGC 1 cut(s) 501
CsiI ACCWGGT 1 cut(s) 46
Csp6I GTAC 2 cut(s) 358, 460
CviAII CATG 5 cut(s) 128, 178, 226, 361, 560
CviQI GTAC 2 cut(s) 358, 460
DdeI CTNAG 2 cut(s) 249, 570
DpnI GATC 4 cut(s) 12, 254, 324, 365
DpnII GATC 4 cut(s) 10, 252, 322, 363
Eco130I CCWWGG 1 cut(s) 455
Eco24I GRGCYC 2 cut(s) 248, 418
Eco31I GGTCTC 1 cut(s) 209
Eco57I CTGAAG 1 cut(s) 338
EcoRII CCWGG 2 cut(s) 28, 46
EcoT14I CCWWGG 1 cut(s) 455
EcoT38I GRGCYC 2 cut(s) 248, 418
ErhI CCWWGG 1 cut(s) 455
FaeI CATG 5 cut(s) 131, 181, 229, 364, 563
FatI CATG 5 cut(s) 127, 177, 225, 360, 559
FbaI TGATCA 1 cut(s) 363
FblI GTMKAC 1 cut(s) 477
FriOI GRGCYC 2 cut(s) 248, 418
GlaI GCGC 1 cut(s) 500
HaeIII GGCC 1 cut(s) 374
HhaI GCGC 1 cut(s) 501
Hin1II CATG 5 cut(s) 131, 181, 229, 364, 563
Hin6I GCGC 1 cut(s) 499
HinP1I GCGC 1 cut(s) 499
HincII GTYRAC 1 cut(s) 478
HindII GTYRAC 1 cut(s) 478
HindIII AAGCTT 1 cut(s) 567
HinfI GANTC 1 cut(s) 512
Hpy166II GTNNAC 3 cut(s) 302, 391, 478
Hpy188I TCNGA 1 cut(s) 265
Hpy188III TCNNGA 2 cut(s) 208, 226
Hpy8I GTNNAC 3 cut(s) 302, 391, 478
HpyAV CCTTC 4 cut(s) 125, 313, 376, 437
HpyCH4III ACNGT 1 cut(s) 136
HpyCH4IV ACGT 1 cut(s) 393
HpyCH4V TGCA 2 cut(s) 69, 518
HpyF3I CTNAG 2 cut(s) 249, 570
HpySE526I ACGT 1 cut(s) 393
Hsp92II CATG 5 cut(s) 131, 181, 229, 364, 563
HspAI GCGC 1 cut(s) 499
Ksp22I TGATCA 1 cut(s) 363
Kzo9I GATC 4 cut(s) 10, 252, 322, 363
LmnI GCTCC 2 cut(s) 28, 531
LpnPI CCDG 9 cut(s) 15, 19, 33, 42, 60, 60, 254, 356, 397
LweI GCATC 1 cut(s) 541
MabI ACCWGGT 1 cut(s) 46
MaeII ACGT 1 cut(s) 393
MalI GATC 4 cut(s) 12, 254, 324, 365
MboI GATC 4 cut(s) 10, 252, 322, 363
MboII GAAGA 2 cut(s) 338, 560
MflI RGATCY 2 cut(s) 252, 322
MhlI GDGCHC 2 cut(s) 248, 418
MluCI AATT 4 cut(s) 79, 273, 333, 533
MnlI CCTC 1 cut(s) 274
MroXI GAANNNNTTC 2 cut(s) 159, 342
MseI TTAA 1 cut(s) 141
MspA1I CMGCKG 1 cut(s) 74
MspR9I CCNGG 2 cut(s) 30, 48
Mva1269I GAATGC 1 cut(s) 501
MvaI CCWGG 2 cut(s) 30, 48
NdeII GATC 4 cut(s) 10, 252, 322, 363
NlaIII CATG 5 cut(s) 131, 181, 229, 364, 563
NlaIV GGNNCC 2 cut(s) 324, 527
NspI RCATGY 2 cut(s) 181, 563
PagI TCATGA 1 cut(s) 225
PaqCI CACCTGC 1 cut(s) 24
PciI ACATGT 1 cut(s) 559
PctI GAATGC 1 cut(s) 501
PdmI GAANNNNTTC 2 cut(s) 159, 342
PfeI GAWTC 1 cut(s) 512
PscI ACATGT 1 cut(s) 559
Psp6I CCWGG 2 cut(s) 28, 46
PspGI CCWGG 2 cut(s) 28, 46
PspN4I GGNNCC 2 cut(s) 324, 527
PsuI RGATCY 2 cut(s) 252, 322
PvuII CAGCTG 1 cut(s) 74
RsaI GTAC 2 cut(s) 359, 461
RsaNI GTAC 2 cut(s) 358, 460
SalI GTCGAC 1 cut(s) 476
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 4 cut(s) 10, 252, 322, 363
ScrFI CCNGG 2 cut(s) 30, 48
SduI GDGCHC 2 cut(s) 248, 418
SexAI ACCWGGT 1 cut(s) 46
SfaNI GCATC 1 cut(s) 541
SfcI CTRYAG 1 cut(s) 148
SmlI CTYRAG 2 cut(s) 206, 494
SmoI CTYRAG 2 cut(s) 206, 494
Sse9I AATT 4 cut(s) 79, 273, 333, 533
StyD4I CCNGG 2 cut(s) 28, 46
StyI CCWWGG 1 cut(s) 455
TaaI ACNGT 1 cut(s) 136
TaiI ACGT 1 cut(s) 396
TaqI TCGA 1 cut(s) 477
TasI AATT 4 cut(s) 79, 273, 333, 533
TatI WGTACW 1 cut(s) 357
TfiI GAWTC 1 cut(s) 512
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TscAI CASTG 3 cut(s) 139, 321, 416
TspDTI ATGAA 5 cut(s) 72, 98, 172, 214, 242
TspRI CASTG 3 cut(s) 139, 321, 416
XapI RAATTY 2 cut(s) 79, 533
XceI RCATGY 2 cut(s) 181, 563
XmiI GTMKAC 1 cut(s) 477
XmnI GAANNNNTTC 2 cut(s) 159, 342
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.